Skip to content

Homework Help

For assistance with (but not answers to) homework problems.

Homework Help Rules

A simple reminder to all: this is the "Homework Help" forum, not the "Homework Answers" forum. We will not do your work for you, only point you in the right direction. Posts that do give the answers may be removed.

  1. Hello! We took Tin granules measured them in a crucible, with a petri dish to get the weight. We then added about 100 drops of 10M HNO3 and let that sit for 10 mins and heated it, cooled, weighed it, then repeated the heat, cool and weight again. Here's my data: Mass of petri dish, crucible, and cover: 58.771g Mass of petri dish, crucible, cover, and tin granules: 59.761g Mass of reaction after first heating: 60.024g Mass of reaction after second heating: 60.020g Here is the report question: 1.) From the mass of tin and the mass of tin oxide, calculate the mass of oxygen that combined with tin. From the masses of t…

  2. Started by Mario_ragno,

    The fish to be commercialized, has to meet four linear requirements on: weight, length, circumference. If p, l e c are weight, length and circumference, a linear condition is written as ap+Bl+yc-d=0 (a,B,y,d \in R). We acknowledge that there's no fish that can satisfy all four conditions, so we decide to edit them, adding with arithmetic to each of them a term like a,t for each i=1,...,4 where a_i are real numbers and t is the time passed since the fish has been fished. A kind of fish is the quadruplet (p,l,c,t). With this condition we are sure that at least one kind of fish exist that meets all 4 new requirements. Is it possible that there are infinite kinds of f…

    • 0

      Reputation Points

    • 0 replies
    • 839 views
  3. I need help finding a superconductor for Flux Pinning if anyone could post a link it would be very appreciated. Thanks in advance.

    • 0

      Reputation Points

    • 0 replies
    • 696 views
    • 1 follower
  4. Started by ProKallon,

    What is the role of explanatory power in Science?

  5. Started by TheUnknown,

    I am a 14 year old whos passion is physics ,mathematics, biology, chemistry,etc. ALL MANNER OF THINGS!!! And I just wanted to see if anyone knew of any good books to get me started on my education. I have a particular love for electronics and computer software. But anything else will be much appreciated. Videos and such count to. Thanks, Austin Clark

    • 0

      Reputation Points

    • 12 replies
    • 2.7k views
    • 1 follower
  6. Started by Galaxy_Lynxie,

    Hello there! I have a project about making a mousetrap catapult that throws medium sized marshmallows. We have to make it adjustable, and it needs to be ablate fire at a target. Do you guys have any tips? [PS. I only have small VICTORTM mousetrap]

    • 0

      Reputation Points

    • 0 replies
    • 679 views
    • 1 follower
  7. Started by Shahroze,

    Can u tell me if i am going right if i say that the tension in the string is 20N and that 20N is cancelled by the other 20N force i.e F so the acceleration will be zero.

  8. Hi there, For a university project me and my project group have to make a model (in Matlab) of a trifilar pendulum in such a way that it accurately represents the motion of the pendulum in real life. In order to do so we have to come up with all the physics formulas related to the pendulum. One of those is the resistive torque caused by the pendulum disk being in contact with the center shaft. This causes for a resistive torque due to which the disk will be slowed down as it is rotating. My question now is: how can I calculate this resistive torque? I know that Coulumb's friction law equals Ff = μ * N and I am sure I can find out what the friction coefficient …

  9. Started by Billket,

    Show that if you add a total derivative to the Lagrangian density \( L \to L + \partial_\mu X^\mu \), the energy momentum tensor changes as \( T^{\mu\nu} \to T^{\mu\nu}+\partial_\alpha B^{\alpha\mu\nu}\) with \( B^{\alpha\mu\nu}=-B^{\mu\alpha\nu}\). The Lagrangian can depend on higher order derivatives of the field. Attempted Solution: So we have \( T_{\mu\nu}=\frac{\partial L}{\partial(\partial_\mu \phi)}\partial_\nu \phi-g_{\mu\nu}L\), where \( \phi\) is the field that the Lagrangian depends on. If we do the given change on the Lagrangian, the change in \( T_{\mu\nu}\) would be \( \frac{\partial (\partial_\alpha X^\alpha)}{\partial(\partial_\mu \phi)…

    • 0

      Reputation Points

    • 0 replies
    • 831 views
    • 1 follower
  10. Started by rovieno,

    (THEORY) How do I go in calculating the amount of grams of NA2HPO AND NAH2PO4 will be required to prepare 250ml of 0.2mol SODIUM PHOSPHATE buffer of pH 6.4 assuming the pKa (I) is 2.12, pKa (II) is 6.8 and pKa (III) is 12.13 ?!

  11. Started by Kimistry,

    Hello, I have got this question i'm having difficulty with... Here it is: (b) A beaker contains 250cm3 of 0.3 mol dm-3 calcium hydroxide Ca(OH)2 solution. (i) How many moles of calcium hydroxide are present in 150cm3? (ii) What mass of calcium hydroxide is present in the solution? Can someone please help me to breakdown question b(ii), Here is my answer: 250cm3 in dm3 is 250/1000 = 0.25dm3 0.25 x 0.3 = 0.0075 moles of calcium hydroxide so... 0.0075mol x 74mr = 0.555g of calcium hydroxide?

  12. Started by Vet track,

    I need to use the equation wsinθ=nƛ to find w or width. I know θ = 0.6, and ƛ (wavelength?)=655nm. But I have no idea what the n variable means. I looked it up on wiki (well wiki was one of the only site that recognized the equation) and it said "n is any integer". I'm fairly certain plugging in any integer will not produce the correct width. In an earlier equation (tanθ=yn/L) n appears as a subscript. in this case the value I was plugging in was y1 so should I plug 1 into wsinθ=nƛ ?

    • 0

      Reputation Points

    • 4 replies
    • 3.9k views
    • 1 follower
  13. A ball is kicked with an initial speed of 20m/s at an angle of 50° above the horizontal. What maximum height does the ball reach? Equations: Vfx=VicosΘ Δx=VicosΘt Vfy=(VisinΘ)+ay⋅t (Vfy)^2=(VisinΘ)^2+2ay⋅Δy Δy=1/2(Vfy+(VisinΘ))⋅t I know that the final velocity for both x and y is 20m/s if that is the case. The acceleration for the x-direction is 0m/s^2 while its -9.8m/s^2 due to earth gravitational acceleration. Vfy at max height is 0. Known: Vfx and Vfy= 20m/s Θ=50° Vfy=0m/s ax=0m/s^2 ay=-9.8m/s^2 T=? Δy=? Δx=? I'm assuming that the question is asking for max height as Δy in t…

  14. Started by TheDragon,

    • 0

      Reputation Points

    • 3 replies
    • 1.5k views
    • 1 follower
  15. A turtle and a rabbit engage in a footrace over a distance of 4.00km. The rabbit runs 0.500km and then stops for a 90min nap. Upon awakening, he remembers the race and runs twice as fast. Finishing the course in a total time of 1.75h, the rabbit wins the race.A) Calculate the average speed of the Rabbit. ~I knew how to find the avg speed by dividing 4.00km and 1.75h. i got 2.28km/hB) What was his average speed before he stopped for a nap? Assume no detours or doubling back. ~I converted the break of 90min to 1.5h. and i know that more than one step is required to answer this. I just don't know where to start.The question is asking to find the answers in km/h

    • 0

      Reputation Points

    • 11 replies
    • 8.1k views
    • 1 follower
  16. Started by Vet track,

    HI all, I'm studying safety procedures with chemical substances as preparation for a lab, and my question is why copper salts can't end up in a landfill. I know they are highly toxic to living things and landfills have an effect on the environment around them, and that they are dangerous if untrained perssonnel are handling them, but is there more? Thanks!

  17. Started by JudgeDuckie,

    Hello, I am Duckie. Is there anyone who know's questions in the Science Olympiad based on Anatomy and Physiology? It would help a lot! Thank you.

    • 0

      Reputation Points

    • 0 replies
    • 851 views
    • 1 follower
  18. Started by probablygonnafail,

    If you subtract two values that have uncertainty do you add the uncertainty? Do you use absolute uncertainty and then turn it into relative uncertainty somehow or can you use the relative uncertainty? I am doing an assignment on isotonic points for vegetables. I have found percentage change for mass and have uncertainty for initial and final mass and I need to be able to say something like for the found isotonic point relative uncertainty for initial is -+20% and for final it is -+24% therefore the uncertainty for the isotonic point is ____. Not sure if that makes sense but I tried.

    • 0

      Reputation Points

    • 3 replies
    • 1.3k views
    • 1 follower
  19. I have read through the associated text for hours:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2795070/The author says that he weighted for body-weight and body-height, but did not say for which diagram.

    • 0

      Reputation Points

    • 1 reply
    • 1.1k views
  20. Started by Melkor,

    I need to know what a corresponding point means or is, in terms of: Suppose the point P(2,3) is on the function f(x). Find the point that corresponds to P on each function; show or explain how you figured this out. (a) f (x + 4) (b) f (x) + 3 (c) -2 f (x)(d) 1/2 f (x - 5) + 1

  21. This question is not a homework, but it has been bothering me for a long time. If you know the algorithm, please let me know. The detail of the question is https://www.papeeria.com/d/file/15def8a2-7af6-4670-a776-7c9455d90206/15def8a2-7af6-4670-a776-7c9455d90206.pdf/Demo - main.pdf I am a beginner. If the concept is wrong, please correct me.

    • 0

      Reputation Points

    • 0 replies
    • 587 views
  22. I figured out (a) but I am having trouble with (b):(a) What is the efficiency of an out of condition professor who 2.10e5 J of useful work while metabolizing 500 kcal of food energy?(b) How many food calories would a well-conditioned athlete metabolize in doing the same work with an efficiency of 25%?2. Relevant equationsOE + Wnc = OEfη = Work_out / Work_inWork_in = η * work_out3. The attempt at a solutionFor (a) I converted the calories to Joules1 kcal = 4184 J500 kcal (4184J/1 kcal) = 2.1e6 Jη = W_out/W_inη = (2.10e5J) / (2.10e6J)η = 10%(b) I assume I could input the 25% into the equation and work backwards but it's not giving me a correct anwser. I've tried the followi…

    • 0

      Reputation Points

    • 1 reply
    • 2.8k views
  23. Started by metalgear21,

    Anyone help me with this primer design question? I have searched everywhere on the internet but cant seem to get everything I need. So far I understand that https://imgur.com/a/PfwAhO0 Forward primer is: Restriction enzyme start codon Tag Primer 20 bases from sequence of gene EcoRI Strep tag Primer 20 bases of gene So I got 5' GAATTC ATGGCCTCGTGGTCGCATCCGCAGTTCGAGAAGTCGGGGGTG ATGCGGCTCTGCATCCCGCA 3' Reverse primer is: Restriction enzyme Tag …

    • 0

      Reputation Points

    • 3 replies
    • 1k views
    • 1 follower
  24. Started by Zambaku,

    Hello, I an having a bit of trouble with my saltwater batteries, I'm trying to hook them up to get more power but it is not working quite as I planned and could use some hints. I get 0.20v from one saltwater cell, if I couple 2 together I get 0.40v, but if I add more, currently got 4 cells connected, I get 0.13v. They are hooked positive to negative and I use a multimeter to check the voltage, its called "Lini-T UT20B, the setting is the 1.5v battery testing. I use Coper Wire for the positive, and aluminium foil for negative. Hints would be greatly appreciated.

    • 0

      Reputation Points

    • 0 replies
    • 703 views
  25. Started by Edemardil,

    Hi. So I have a rube goldberg I made in Algodoo and I have to finish a qualitative and quantitative description of it. I am getting an A in this class and I don't know why but there are two parts that I am having trouble with in my machine. If anyone can help. #1. The first is the collision on the top of the incline. I have to provide the equations and calculate the transfer of energy and momentum from the ball at the bottom of the ramp to the ball at the top. A ball drops into a hole, rolls horizontally for a few meters then rolls up an incline where it interacts with another ball at the top being held there by a lever. The ball going up the ramp pushed the smaller …

    • 0

      Reputation Points

    • 0 replies
    • 856 views

Important Information

We have placed cookies on your device to help make this website better. You can adjust your cookie settings, otherwise we'll assume you're okay to continue.

Account

Navigation

Search

Search

Configure browser push notifications

Chrome (Android)
  1. Tap the lock icon next to the address bar.
  2. Tap Permissions → Notifications.
  3. Adjust your preference.
Chrome (Desktop)
  1. Click the padlock icon in the address bar.
  2. Select Site settings.
  3. Find Notifications and adjust your preference.