Skip to content

Genetics

DNA replication, Mendelian Genetics, mechanisms of gene expression, and related topics

  1. Started by Kevsen,

    I want to genotype E18 mice as fast as possible. Preferably within a couple of hours. I suppose the bottleneck of this all will be the tissue digestion/ DNA extraction. Does anyone have experience with this and/ or can provide with some digestion tips? What tissue you use? what buffer you use? Fastest I did it until now was 2 hrs , shaking @55 celcius with: 10% Triton 10x MGB H2O Proteinase K Thans in advance guys!

    • 0

      Reputation Points

    • 0 replies
    • 1.4k views
  2. For an exploratory essay, I am considering writing about genetics and intellectual property. However, I need a minimum of three viewpoints. I know there are those who are for patenting genetic discoveries and those who are against it, but I still need a third viewpoint. Can anyone point me in the direction of one or more credible sources that can be considered a third viewpoint? Many thanks.

  3. Started by t-star,

    Just some crazy ideas I'm having that someone with a good understanding of genetics might help me with. Would it be possible for a unique gene or gene combination to be passed down from ancestor to ancestor without anyone else having that gene, but that gene always being passed on? Maybe if all the ancestors only had a single child? So you'd be able to trace that gene back through the generations to an original and nobody else would have that gene/gene combination except one male/female ancestor, say great grandfather > grandfather > grandfather > son.

    • 0

      Reputation Points

    • 5 replies
    • 2.3k views
    • 1 follower
  4. Started by SamTheSkeptic,

    First off hello everyone, I am glad to have joined this forum and look forward to being a contributing member here. My first post is regarding the "DNA ethnicity tests" that many have probably heard of already. These tests analyze your DNA and as far as I have seen, provide results which are traceable ultimately back to 4 major categories: Sub Saharan African, European, Asian, and Indigenous/Native American. What got me thinking was a show that I had seen a while back on PBS, which featured a bunch of well known stars who had these DNA tests ran on them. Many were surprised by the results, which often included categories that they didn't suspect (I specifi…

    • 0

      Reputation Points

    • 18 replies
    • 5.4k views
    • 2 followers
  5. Hello! I am currently attending a lecture called "Statistical Methods in genomics and proteomics" in the course of my master's course in Statistics. Being a real layman in genetics, I have several problems in understanding. I am sorry about the amount of the questions, but asking them the professor would be a bit much I guess. Probably some of the questions will depend on each other, so, I guess, not each has to be answered individually. You may also give rather general answers! I would be very thankful, if some people give answers in a way that is conceivable to a novice! Having already searched the internet, I wasn't able to find answers that were suitable f…

    • 0

      Reputation Points

    • 3 replies
    • 2.5k views
  6. Started by shimaa sherif,

    Biotinidase Defiency is a Genetics Disorder due to the deficiency of The Enzyme Biotinidase To Download PDF Here To Download Powerpoint Here

    • 0

      Reputation Points

    • 0 replies
    • 1.8k views
  7. Started by DTUstudent,

    TECHNOVISION'11 is the technical paper presentation event of TROIKA, the annual technical fest of IEEE student branch of Delhi Technological University (formerly Delhi College of Engineering), Delhi organized in the month of February, 2011. Over the years, Technovision has witnessed an exceptionally enthusiastic participation from students from across the country. Not just the students, but companies like Nokia, Schneider Electric and STMicroelectronics have been involved with it. Papers are invited pertaining to the following streams of science and technology: 1. Electrical and Electronics Engineering 2. Computer Science and Information Technology…

    • 0

      Reputation Points

    • 1 reply
    • 1.9k views
    • 1 follower
  8. congenital blindness-is it hereditary or genetic ? If a blind couple i.e born blind at birth had a child, would it be also born blind ? i.e both parents are born blind - congenital blindness, the child born from them i.e offspring will also be born blind ? thanks & regards, prashant s akerkar

    • 0

      Reputation Points

    • 4 replies
    • 2.4k views
    • 1 follower
  9. Started by Sue-Rica,

    Hi As I am from South Africa, real time PCR is all new to me. I was very excited to use this new technology on my masters project but with great disapointment. I'm looking at polymorphisms in rare gene so a positive control was not possible at first. Because of this the automatic allelic discrimination software doesn't call work as well. So the big problem is manual genotype calling using the amplification plot. Now this was a big joke. Nowhere can you find info on how to do it. I contacted three reps which included Bio-Rad, Applied Bio and Roche. According to all of them when you get two signals (FAM and VIC) no matter what the amplification of each then you can…

    • 0

      Reputation Points

    • 6 replies
    • 4.8k views
  10. Hi All, I Am Looking for a bit of information, as you might note my name i am At the moment attempting to write a book, and am researching for said novel, although it is Sci-Fi/Fantasy in Genre. I Have two seperate questions for the genetisists, (did i spell that right?) My First Question is a little bit silly as it is taken from a video game, it is a theory expressed throughout the Assassin's Creed franchise and i am questioning whether or not it has any validity, it is called the theory of genetic memory on the game, and it says that not only are your genes used to give form, but asa basis for your learning ie. instincts, i hope i explained that right haven't pl…

    • 0

      Reputation Points

    • 2 replies
    • 1.9k views
    • 1 follower
  11. Started by Curran c doddabele,

    One day I was explaining the how the digestive system works then she suddenly asked me how does urination take place I still have not found out can anybody help me

    • 0

      Reputation Points

    • 2 replies
    • 1.3k views
    • 1 follower
  12. Started by lennon,

    I'd like to know what are the motives for certain genes beeign dominant? [some people seem to believe that "beacuse they get expressed over those that are ressesive" is an answer, I don't (I understand why they are called dominant and what's the concept behind, what I want to know is what's the reason for this dominance). ] Is the real cause known at the present time?

    • 0

      Reputation Points

    • 9 replies
    • 4.8k views
  13. Started by Curran c doddabele,

    One day I was explaining the how the digestive system works then she suddenly asked me how does urination take place I still have not found out can anybody help me

    • 0

      Reputation Points

    • 2 replies
    • 1.9k views
  14. Started by tjp31,

    Could lactic acid be responsible for increase telomerase activity in some forms of cancer? If so could you point me towards some scholarly articles.

    • 0

      Reputation Points

    • 1 reply
    • 1.4k views
  15. I am in a somewhat strange position. I'm trying to assess my genetic limits to better understand where I should go from here. I have attention deficit disorder but was somehow able to make it through a top university and am now a new assistant professor at a top 15 in my field. I don't think I deserve to have gotten here, but somehow, I did. The question is whether I'll be able to make it any further, and as for most things, the genes probably hold the answer. My grandparents and great-grandparents were, for the most part, extremely intelligent and industrious people. There's one exception: my great grandfather. His family wanted him to be an accountant but he…

    • 0

      Reputation Points

    • 2 replies
    • 1.5k views
  16. Started by Miklos Bajay,

    Blog: http://oligonucleotidedesign.blogspot.com/ http://populationgenetic.blogspot.com/

    • 0

      Reputation Points

    • 1 reply
    • 1.6k views
  17. Started by scilearner,

    Hello everyone, 1. Restriction enzymes cut only sugar phospahte bonds right. So in the formation of sticky bonds for example in BamHl, how does the hydrogen bonds between the molecules break. When sugar phophate bonds on each strand break, does it pull on the free side dissociating the hydrogen bonds. Can these pieces stick back easily again or do they need a ligase? 2. Can restriction enzymes cut single stranded DNA? 3. Also how do these detect specific sequences of DNA. Do they have some complementary area that binds with the specific region. Thanks

    • 0

      Reputation Points

    • 2 replies
    • 12.3k views
  18. 1. Ok in the plasmid we used the ECOR1 to create sticky ends. Now my question is when we add DNA ligase, why don't these ends stick back again. How are we able to add new DNA piece in between. Basically what I'm saying is when ECOR 1 creates sticky ends in plamids, why do they separate the plamid, don't the sticky ends stick back together. 2. Also why can't DNA ligase bind the blunt ends, can't it fix the phosphodiester bond there. Thanks

    • 0

      Reputation Points

    • 2 replies
    • 3.5k views
  19. Started by gentr,

    I have very little experience in the field of genetics and would really appreciate your help. This is a highly-acclaimed paper, published in a very reputable journal; however, I have been told that there are some issues with it. Do you see what could be improved? Thanks in advance! Genetic variants in TPMT and COMT are associated with.pdf

    • 0

      Reputation Points

    • 3 replies
    • 2.8k views
  20. Started by Renat-KZ,

    Hi everyone! What differ a strain of animals from breeds of animals? In my opinion animals of different breeds differ in more external appearance, rather than physiologically. For example, dogs French bulldog and German shepherd. The laboratory rats or mice for external appearance not differ as dogs. But physiological very differ. For example, Wistar rat's strains more often develop spontaneous cancer than Sprague-Dawley. The Wistar-Kyoto rats have high blood pressure etc. In my opinion should be specified as inbred or outbred animals, noting the name of the breed (Wistar, Sprague-Dawley, CD-I, Swiss Webster etc).

    • 0

      Reputation Points

    • 2 replies
    • 3.9k views
  21. Started by mattjackson4,

    Heres an easy one: CACAUUAUGUAUAAUGCAAUGGAAAUCUCCAUGGCGACUACUAUUUCAGAGGAAAAAGCAGGUGAAAAUGAGACUAUUUGUUCACCCCUCGCAUGCGAAAUGGAGAAUACUUGUGCGAAUUACGCACACGAACUCCCC email mattjackson4@hotmail.co.uk when youve got it shouldnt be hard

    • 0

      Reputation Points

    • 1 reply
    • 1.2k views
  22. Started by admrpeter,

    My website is (deleted. Advertising not allowed) . There is too much BS in this this discussion not enough hard results. THERE IS NOT SUCH THING AS AN EXPERT IN ONCOLOGY obviously because more than 70% of the patients die. it is the most depressing area of medical science. Show your HARD Stuff of shut up

  23. Started by dttom,

    I heard from a lecture of major occurrance of Down's syndrome in female, but when I check for verification I found male to female ratio at 1.3 to 1. So maybe something wrong there, but this leads me to think about why one sex will be more susceptible to some genetic disease like chromosome 18 trisomy. Any suggestion?

    • 0

      Reputation Points

    • 1 reply
    • 1.5k views
  24. Started by ewmon,

    I've studied developmental biology, but I have not yet seen anything that explains how gametes actually "live". I think of DNA as the software of the cells. We know that gametes (sperm and unfertilized eggs) are alive and perform various functions; however, ... Has science uncovered how their DNA operates? Is their existence as gametes simply the "default" consequence of having only half of their DNA? Or (because gametes of diverse species behave very similarly) do gametes simply suppress their "organism" DNA/software (which runs after fertilization occurs)? So, do gametes (and, by extension, do all cells in our bodies) have two sets of software -- what might…

    • 0

      Reputation Points

    • 2 replies
    • 1.4k views
  25. Started by Raoul,

    Is it possible by any means necessary to change the genetic make up in the triceps

    • 0

      Reputation Points

    • 23 replies
    • 3.9k views
    • 1 follower

Important Information

We have placed cookies on your device to help make this website better. You can adjust your cookie settings, otherwise we'll assume you're okay to continue.

Account

Navigation

Search

Search

Configure browser push notifications

Chrome (Android)
  1. Tap the lock icon next to the address bar.
  2. Tap Permissions → Notifications.
  3. Adjust your preference.
Chrome (Desktop)
  1. Click the padlock icon in the address bar.
  2. Select Site settings.
  3. Find Notifications and adjust your preference.