Skip to content

Genetics

DNA replication, Mendelian Genetics, mechanisms of gene expression, and related topics

  1. Started by panayi1,

    Given the sequence: TCAGTTCAGCCCTCACCATTGCTCTGCAACTCAGAACAGTTACTACTGAGACTACCCTGAGAAGAGGATG GTCCTAAACAGAGCTCTGATTCTGGGGGCCCTCACCCTGACCACCATGACAAGCCTCTGTGGAGGTGAAG ACATTGTGGCGGACCACGTTGGCACTTATGGCACAGACTTCTACCAATCTCATGGTCCTTCTGGCCAGTA CATCCACCAATTTGATGGAGACGAGGAGTTTTATGTGGACCTGGAGAAGGAAGAGGCTGTCTGGAGGCTG CCTATGTTTGATAAATTACGTTTTCACCCGCAAGGTGCACTGAGAAACATAGCTATAGCGAAACACAACT TGGATGTTCTGACAAAACTCTACAACTTTACCCCTGTTATCAATGAGGTTCCAGAGGTGACTGTGTTTTC CAAGTCTCCCGTGATGCTGAGTCAGCCCAATACCCTCATCTGTCACGTGGACAACATCTTTCCCCCTGTG ATCAACATCACATGGTTGAGAAACGGGCACTCTGTCACAGAGCATGTTTCTGAGACCAGCTTCCTCCTCA GAAGTGATTATTCCTACCTCAAGATAAGTTATCTCCCCTTCCGCCCTTCTGATGAT…

    • 0

      Reputation Points

    • 0 replies
    • 899 views
  2. Started by valac,

    Hello. I need to know the simplest method of doing a point mutation experiment (single-base substitution) on a sample of DNA? I'm very new to this, so the simpler/more well explained, the better. Particularly, I want to perform the mutation to gene trichohyalin-like-1 (TCHHL1). It's on Chromosome I (map position 1q21.3), to change AA to GG (separately) on SNP rs17646946. The TCHHL1 samples I have are 5 shRNA clones of Lentiviral vector type. This is my first experiment with genetic mutation for personal research, so even an outline of a basic method of point mutation in general would be helpful. I'm looking for a more simple tutorial than what I've seen thus …

    • 0

      Reputation Points

    • 1 reply
    • 1.7k views
  3. Started by nikk,

    why does an organism die? is it because it cannot divide further[i mean its cells] or does the gene 'pre- plan' its termination ? i am a beginner in this and i dont know much.

    • 0

      Reputation Points

    • 1 reply
    • 1.2k views
    • 1 follower
  4. Started by Caniscus lupusco,

    what would the genetical impacts of implanting the genes from a animal (eg the gene that gives cats excellent vison at night) in a human, would the gene even be accepted, or would it have serious health risks?

    • 0

      Reputation Points

    • 5 replies
    • 1.8k views
    • 1 follower
  5. Started by student13,

    Fly genetics.13.pdfFly genetics.13.pdf I am new to learning fly. Can anybody give me some useful information about UAS-Gal4 system, P-elements and balancer chromosomes and how to generate a transgenically modified fly using above tools. When happens when you cross these two flies----- Ddc + X SP TM6 B ------- ; ----- ----------- ; --------------- Ddc + Cyo TM2 I have no idea about this. Please help me. Please see the attachment if above problem looks funky.

    • 0

      Reputation Points

    • 0 replies
    • 1.6k views
  6. Started by bettywong,

    Hello everybody, I'm new to this forum. I was searching online where I could ask a genetic question, as I got stuck in my work...then I found here....any opinions are much appreciated... Okay, jump into the problem...I'm doing a genetic association study, and considering to combine 2 East Asian population (i.e., Japanese and Taiwanese) as one to somehow increase the sample size, thus improve the power of the study. But I found out the gene we are looking at showed different allele frequency distributions in Japanese and Taiwanese, e.g., A-allele frequency is 0.48 and a-allele freq. is 0.52 in Japanese; but A-allele freq. 0.56, a-allele freq 0.44 in Taiwanese for t…

    • 0

      Reputation Points

    • 6 replies
    • 2.3k views
    • 1 follower
  7. Started by Ehsan Alirahimi,

    Hello, Does any one know why people with down syndrome in the world show thesame (not exact) phenotype (such as underdeveloped teeth and foul-smelling urine ). many thanks in advance.

    • 0

      Reputation Points

    • 5 replies
    • 2.7k views
  8. Started by middleschool,

    I have to give this question to my 6th grade science class. As scientists, please answer it like you would on a test: A green bean plant has a genotype of Ttyy, what are the possible genetic combinations that could be present in a bean from this plant? A) Ty, ty B) TT, Tt, tt, yy C) Tt, yy D) Tt, yy, Ty, ty 16)

    • 0

      Reputation Points

    • 5 replies
    • 2.1k views
  9. I've been tasked with a relatively interesting assignment: a review manuscript on the biotechnological applications of adipose-derived stem cells (ASCs). I've gathered a fair number of articles discussing how ASCs (which I understand are mesenchymal stem cells, MSCs) can be extracted from human adipose tissue and made to differentiate into at least three different varieties of tissue. One paper clarifies methods for inducing differentiation into three different tissues specifically: bone, cartilage and adipose tissue. I suppose I'm off to a good start. Still, the story doesn't end there. I'm looking for the challenges that ASCs face, particularly technical chal…

    • 0

      Reputation Points

    • 2 replies
    • 2.5k views
  10. So after further analysis and comparison there has been a shift of diagnosis from insertion to inversion, which I'm told is more favorable in terms of prognosis. The inversion in the male fetus has been determined as essentially the same as the inversion in the mother: Mother karyotype = 46, X, inv(X)(p11.23q21.2) Male fetus karyotype = 46, Y, inv(X)(p11.23q21) Presently a chromosomal microarray is still pending on the mother and baby. Also a karyotype is being obtained on the mother's lone brother. We've been told that firstly because the pericentric inversion is apparently the same for the mother and baby that this is a good sign of normal phenotype. However…

    • 0

      Reputation Points

    • 0 replies
    • 2k views
  11. Hello, My family member is 20 weeks pregnant and has recently had an amniocentesis done to see if the fetus has any chromosomal abnormalities, as she herself has a pericentric inversion of the X chromosome. She is (46,X,inv (X) (p11.23q21.2)). She was told that she'd likely have a female child as inheritance in a male would be fatal and besides having difficulty becoming pregnant the likelihood of having issues in the offspring was low. However, after the amniocentesis, it has been discovered that it is indeed a male fetus that has an insertion instead of the expected inversion and is, 46,Y,ins(x)(p22.1q13q22). She is having difficulty gathering reliable and common info…

    • 0

      Reputation Points

    • 3 replies
    • 2.1k views
  12. Started by Climbing Air,

    So I'm writing a piece of fiction based on the introduction of a new allele, and since I'm not a scientist, I have a few questions. The existing allele is a wild gene and the new allele is dominant. In my story, a single individual introduces the new allele to the world and it quickly populates due to natural selection. I'm wondering if 'a' could ever become completely extinct? I know that 'Aa' would dominate but could 'AA' ever take over? Or would 'AA' need a survival advantage over 'Aa' too? Later in my story, I was thinking of introducing a third allele which I will call 'B'. This allele is dominant to 'a' as well and using a bit of creative license, 'A' an…

    • 0

      Reputation Points

    • 11 replies
    • 2.8k views
  13. Started by kitkat,

    I recently read where the DNA sequences between Humans and Chimps are nearly identical 100% but in bird species they are not identical across the board. It is now believed that the differences between us and chimps is how these sequences are turned on and off and to what degree in protein produced in each group. My question is why are there differences in different species of bird sequences? Shouldn't they be all identical in sequences but different in how they are expressed?

    • 0

      Reputation Points

    • 19 replies
    • 6.5k views
    • 1 follower
  14. Started by genetics24,

    In my class we're learning about enhancers. Enhancers have modular organization, meaning one part of them does one thing and another part does another, but collectively they make up the gene's function. Different parts are also expressed in different areas of the body. For example, we learned about the PAX6 gene. This gene has several enhancers that are expressed in differents parts of the body. For instance, one enhancer is for the retina nad another is for the pancreas. What would happen if an enhancer was turned on in a part it wasn't supposed to be? For instance, if the pancreas enhancer was turned on in the retina. Is this even possible?

    • 0

      Reputation Points

    • 0 replies
    • 868 views
    • 1 follower
  15. Started by E=McMuffin,

    Dear Egg Heads, Mensa Affiliaties and Brainiacs, I recently discovered that in an area of Siberia, wild Silver Foxes had through natural selection or more appropriately through selctive breeding become domesticated in the matter of just three generations. Thier domestication had made them not only tamer but more dog like. Thier is a related artical on Wikipedia if you care to research yourself through this link - Domesticated Silver Fox My question relates to pet dogs and specifically dangerous dogs. All domesticated dogs are genetically related to wolves and through history they were breed through selective breeding for different purposes. The German Shepard a…

  16. Started by PPL,

    Do think MUTANT are exist or they will in the near future? One day in 1999 a little baby boy was born in Germany, at first glance no different from any other. But, the nurses noticed that the baby's muscles were twitching and called the doctors to check him out. We can only assume Uberbaby was showing off his guns to the ladies since when doctors examined the kid, they reached a unanimous conclusion: he was ripped as hell. But how did this happen? Was there a fully equipped gym inside his mom's uterus? No, as it turns out that's an extraordinarily stupid idea. It's actually a real X-Men-style genetic mutation that changes the way his body controls muscle growth…

    • 0

      Reputation Points

    • 6 replies
    • 3k views
    • 1 follower
  17. With the same genes for eyebrows (genotype), does the fact that someone is a female mean she will have thinner eyebrows and if a man, thicker eyebrows (different phenotype)? Or is the thickness the same, genetically determined but unrelated to gender? I know many women pluck their eyebrows which makes these look thinner and therefore the overall impression is that women have thinner brows....but for example I am female and have natural eyebrows as thick as my father's (I pluck them too of course).. So, if I have a son and give him my eyebrow genes for thickness, will he have even thicker eyebrows? Or as thick as me? For the last question, please consider my husband …

    • 0

      Reputation Points

    • 1 reply
    • 4.2k views
  18. Started by Smoke,

    Hi, I'm new, and I hope this is okay. I've been in a debate for a while about this, and would really like it if I could get an answer that I could understand. I'm more or less a layman with some reading, so be gentle with me. It's basically this: Is trisomy technically considered genetic mutation, or is it not? I have been saying it's not, since it's not a change in alleles, the DNA inside the extra chromosome isn't changing. The other side is that I should be more flexible with my definitions and that it's a mutation because it affects the body like a mutation, and I'm just not buying that. Help?

    • 0

      Reputation Points

    • 2 replies
    • 1.3k views
  19. Started by bbouch111,

    I have a hypothesis regarding our eye sight and what and how we see color. My hypothesis is that if we all learn from a young age through relating items and colors to a word, and since we can't see through some one else's eyes, do we all see the same color to it's name? Explanation: Color Variable1: (X) Color Name To Variable1: (X2) So we learn that if we see the color (X) that we relate it to the name (X2). Color Variable2: (Y) Color Name to Variable2: (Y2) So we learn that if we see the color (Y) that we relate it to the name (Y2). If we learn this way, which as far as any person knows, we do. How don't we know that if we say (Y2) one person doesn't see (X) a…

    • 0

      Reputation Points

    • 3 replies
    • 1.6k views
  20. Hi people, I figured Id try posting here before perhaps another site- Olives traditionally need another tree to cross pollenate or you will get no fruit. (recently, self pollenating trees have been "bred", though). My only question is: If one clones another tree from say, the mother tree, then wait a few years for growth, would those then 2 trees cross pollenate effectively or does it HAVE to be another individual tree (with different genetics, of course) to pollenate? (I clone olive trees from snipping the tips of twigs. difficult, but I figured out the trick. Now, only need to know if all these clones are useless with each other. If so, no big problem- I'll jus…

    • 0

      Reputation Points

    • 2 replies
    • 1.5k views
  21. Started by yaracuyKirkhoff,

    There are 23 sets of chromosome among them, is there a chromosome that is more involved with neurons in the brain functioning ? Is there a chromosome among the 23 sets that is involved more with the nervous system ?

    • 0

      Reputation Points

    • 5 replies
    • 2.8k views
  22. Started by nath88nael,

    A branch of Eastern medicine claims that the body is capable of creating new organic compounds to meet the needs of the practitioner. from what i understand, this is done by focusing on the intended outcome, while the subconscious works to achieve it. i imagine the argument may lead as follows: "is it possible for the body to make new compounds" - "yes, it's called evolution" "is it possible for the body to evolve so quickly as to make new compounds on an individual basis" or "is every genetic change one of an anomoly present from birth"

    • 0

      Reputation Points

    • 6 replies
    • 2.3k views
  23. Started by dhand,

    Hello, i will start with the disclaimer that i am not a scientist, so please forgive me if my question seems a little... silly. However i am curious about my genetic 'anomaly'. I was wondering if anyone can shed some light on this... I am white British and I have dry ear wax. (as opposed to the wet variety) The gene that determines wet/dry earwax is ABCC11. This gene is recessive. A Japanese team of geneticists found that only 0-3% population of Europe had dry earwax and occurs mainly in East Asia with 80-90% of the population, followed by native Americans at 30% of the population. So my condition geographically is rare. My problem is that both my pare…

    • 0

      Reputation Points

    • 4 replies
    • 5.4k views
  24. Crossing-over partial occurrence between X chromosome and Y chromosome is the key of intersex. I have contacted almost all of the so-called female orgasm researchers and organizations, but no one trusted me. Why such a fact is so difficult to accept by people? Why do they insist on a false and illusory assumption that women can have multiple orgasms? What I wrote are all facts, but```````. I am not an expert in intersex, but I propose a new theory here about intersex to help you to understand female orgasm better. Intersex , in humans and other animals, is the presence of intermediate or atypical combinations of physical features that usually distinguish female f…

    • 0

      Reputation Points

    • 1 reply
    • 5.6k views
  25. Started by Sasoritattoo,

    Hi, guys, I‘m a junior programmer. And I have a little understanding of genes. One day, I accidentally had an funny idea. And it's so cool that I couldn't help myself to share it. I just want to know what is the value of my idea. There is the link http://www.scienceforums.net/topic/60315-if-god-is-a-programmer/ I hope the administrator don't delete my post. I just want some gene researchers understand my mind. Not to be understood is a so painful feeling. Thank you.

    • 0

      Reputation Points

    • 0 replies
    • 1.1k views

Important Information

We have placed cookies on your device to help make this website better. You can adjust your cookie settings, otherwise we'll assume you're okay to continue.

Account

Navigation

Search

Search

Configure browser push notifications

Chrome (Android)
  1. Tap the lock icon next to the address bar.
  2. Tap Permissions → Notifications.
  3. Adjust your preference.
Chrome (Desktop)
  1. Click the padlock icon in the address bar.
  2. Select Site settings.
  3. Find Notifications and adjust your preference.