Skip to content

Biochemistry and Molecular Biology

Discussion of protein structure, energetics, and molecular biology.

  1. Started by amorley2013,

    Hello, I just recently graduated with a BS in Biochemistry and am having difficulties finding a job. I was wondering if anyone had any suggestions as to good companies to apply to and for future schooling. What are some things that you did after graduating with a biochem or similar degree? If anyone has any advice that would be great. Thank-you!

    • 0

      Reputation Points

    • 0 replies
    • 1.1k views
  2. Started by AlanaC,

    Heya, Stumbled upon an problem. We are trying to create nutrient broth with a range of concentrations of lead acetate in order to grow lead-tolerant bacteria. The problem is, when we add the lead acetate solution to the nutrient broth it immediately precipitates, it then reacts and changes from a white precipitate to a grey/black precipitate when we autoclave it. Anyone got a solution? We know its been done before, but we don't know how and seem to be missing something... Thanks

    • 0

      Reputation Points

    • 0 replies
    • 1k views
  3. Started by Raphael123,

    Hello everybody, My question is this: Imagine that you guys had a mitochondria(s) and a recently new discovered compound. How would you do to see if this new compound acts within the mitochondria? How you would know if this compound is, for example, inhibiting the electron transport chain? or destroying mitochondrial membranes? How to see if the compound acts or not in the mitochondria. Thanks

    • 0

      Reputation Points

    • 1 reply
    • 1.3k views
  4. Started by anastasia,

    Dear all, I am a master student and i just began with siRNA transfections. I have some problems with the scramble. My scramble always give dead cells, so the results couldn't be used. Then only thing that I do differently from what i ve been demonstrated was that i place first the siRNA/scramble drop and after the siRNA buffer in the eppendorf. But that can't be the case, can be? Could you please help? I am trying to find what is going wrong. Only once it worked and i had alive cells in the scramble. I work with a 12-well plate and only mine scramble gives dead cells. Any ideas?

    • 0

      Reputation Points

    • 2 replies
    • 1.3k views
  5. Started by Asha,

    Would 8 M urea brake up E. coli cells? If you had them in a pellet, used enough 8 M urea and only resuspended it?

    • 0

      Reputation Points

    • 1 reply
    • 2.2k views
  6. I mean, lets assume theres no fat/oils/starches in the can. Isnt a 6 oz can of tuna 6 ozs of "protein, for practical considerations? Some doctor here is telling the wife its not true- that all shes getting is a fraction of that in "real" protein........

    • 0

      Reputation Points

    • 8 replies
    • 6.8k views
    • 1 follower
  7. Hello everyone, This is my first post here. I am trying to purify artemisinin from an ethanolic extract of Artemisia annua (sweet wormwood), and I ran into the the typical problem encountered by biochemists doing this procedure: removing the plant waxes without losing artemisinin. Most of the literature I have come across recomends using petroleum ether or hexane to defat ethanolic plant extracts. This would not work in my case because artemisinin happens to be very soluble in both of those solvents (in fact, hexane is used for industrial-scale production of artemisinin). I read a tip somewhere about using molten parafin wax, but that just removes the fats (as far as …

    • 0

      Reputation Points

    • 1 reply
    • 2.5k views
  8. For starters I have a relatively basic understanding of biochemistry and metabolic pathways, etc. I've been wondering, in order to build muscle you require a caloric surplus which in general means a greater generation of energy (ATP) in order to synthesize proteins to help with the repair of muscle damage in muscle cells. So IF I consume a shot of alcohol, it enters into my body and is rapidly converted to acetate through a number of metabolic pathways. Now if acetate is converted to acetyl-CoA (which in the end can result in either fat synthesis or ATP synthesis) and I am in a state of required energy, acetyl coa is going to be used in the process of ATP synthesis. As a …

    • 0

      Reputation Points

    • 1 reply
    • 1.1k views
  9. Started by Fab,

    Im new to these forums so hello to everyone here! I hope im posting in the right place about this subject? So im not very scientifically knowledgeable so my simple searches online are not resolving my curiosity :/ so i figured ill just ask the right people! so.... 1. Is the ONLY gas needed for leaves co2? 2. Is the ONLY gas needed for roots o2? 3. For both gases above if I were to mix them with a gas to get the right concentration, what gas would have no effect on the growth/chemistry and be easy to obtain? Next im curious as to the general gas concentrations needed for roots/leaves. If this is a stupid question then please feel free to use a…

    • 0

      Reputation Points

    • 0 replies
    • 1k views
  10. hi all, have anyone ever tried to determine Tryptophan in high yields from protein hydrolysis ? I've read many experiments sheets indicating destroying of Trp by acid hydrolysis. and many alkaline hydrolysis will lead to a best 80% Trp protection. I really don't wanna waste assets on failure. any help on what can i do will be greatly appreciated.

    • 0

      Reputation Points

    • 0 replies
    • 877 views
  11. Started by BlahBlahBlah,

    I've got some predcited protein structures, and I want to see how well they match against another one from the Protein Databank. See the attached files. I-TASSER and EsyPred3D and predict protein were all used. What I designed was an ScFv, and now I need to see how similair it is to something else. I have no idea what I;m doing other than that. The text document is the peptide sequence I designed. Any help appreciated.. I-TASSER results for your_protein.zip ESyPred3D.zip sequence (bad areas removed).txt

    • 0

      Reputation Points

    • 1 reply
    • 1.1k views
  12. This should be a fun one! Does mineral oil prevent excretion of toxins from skin? I know we excrete toxins from the skin, but that's after toxins are processed by the liver, kidneys and intestinal tract. I don't know the respective percentages of toxins dealt with by each organ (if you do, please share) , but I think it indicates you're most likely to excrete your toxins via urination and feces rather than via sweat. I also know that mineral oil is used on the skin of ocean swimmers to prevent chill and that mineral oil is digested to aid with constipation because it coats the intestinal track, allowing for re-hydration of feces (oh yay!). Anyway, can anyo…

    • 0

      Reputation Points

    • 5 replies
    • 2.7k views
    • 1 follower
  13. Started by sdem1,

    Hi, I've been trying to run gels for a series of PCRs to test primers. However the bands so far have been curvy, slanted and very unclear. I then tested a 100bp and 1kb marker in a gel I made to check that the error is from the gel electrophoresis and not the PCR. A similar problem occured however, and I can't seem to figure out what is wrong. I'll attach both pictures. The first gel was run at 80V and is a 3% gel. The second gel is also 3% and it was run at 90V. The third gel is 2% run at 100V. If anyone has any ideas on what to fix that would be great. Thanks!

    • 0

      Reputation Points

    • 1 reply
    • 1.9k views
    • 1 follower
  14. Hello, I have two proteins which one is wt protein, and one is mutant of the same protein. I should denature both proteins in the same conditions with 5 M urea and do NMR on both of them and they should be exactly in the same conditions. I already used protoparam tool in expasy and found the extinction coefficient of mutant and is smaller than wt, but when I denatured the protein and did NMR on them, the NMR spectrum of mutant dropped about 30%, but based on expectation, it should only drop about 15 percent. I have a problem to find their exact concentration. Can you please give me a way to calculate extinction coefficient of the mutant and wt. Thanks.

    • 0

      Reputation Points

    • 0 replies
    • 936 views
  15. Started by debamalya,

    i want to test my RNA purity. i orders a sequence and i think it's also contain other sequence with the same length, please help me , how to evaluate the purity?

    • 0

      Reputation Points

    • 0 replies
    • 945 views
  16. Dear all, First of all I have to say that I am not really experienced with cells and proteins isolation. My question is that I wanna isolated Histone H1 from a type of cells. There are a lot of reports, but all of them used acidic conditions (perchlorid acid, sulfuric acid, trichloroacetic acid...) and thats something that I would like to avoid. In some of the cases I understand that such conditions are used to precipitate the proteins and in others I guess that are to break/lyse the cell membrane nucleus. Are u aware of any method to isolate proteins from the nucleus avoiding acidic conditions? And second question, why such acids are being used to isolated such prote…

    • 0

      Reputation Points

    • 2 replies
    • 1.5k views
  17. I am trying to use beta Estradiol as a compound to test in cell culture, and it is only dissolvable in ethanol, and whenever I try to carry out serial dilutions to carry out the dilution to nanomolar levels, the hormone seems to come out of solution rapidly. Any pointers/tips/advice for a grad student in need?

    • 0

      Reputation Points

    • 3 replies
    • 4k views
  18. Started by juannajuann,

    Hi, I just received the sequencing lists for my unknown bacterial. There are 5 unknown bacteria that I need to identify. I would like to identify the bacteria using blastn and construct phylogenetic tree using neighbor joining. Can anyone help me how to do it, since I not sure and familiar with it. Please help me as fast as possible. Thanks. Below are the lists of my sequencing results. >1st_BASE_1215970_B_subtilis_168_Bacillus_Family_F.ab1 GGATTTCATATATTCGTCCTACAGCTAGCGTCATTGGAACTGGCATGTAAACTGGGATACCTCCGGGAAACCGGGGCTGA TACCGGATGGTGGTTTAAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCACTTACAGATGGACCCGCGGCGCA TTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGATGCGTAGCCGACC…

    • 0

      Reputation Points

    • 0 replies
    • 1.3k views
  19. Started by nazych,

    Hi, We have an amsco lab 250 autoclave in our department. When yesterday I wanted to autocalve my flasks for growing bacteria, i saw it was saying "all utility shut down" i hit cancel on the screen and did autoclave. Today when i tried to autoclave and hit cancel it went to main menu and i choosed my option, but it did not start to autoclave and again it went to "all utility shut down" and when i hit cancel again it did not do anything and emained shut down, it seems touch screen does not do anything. Can some body help me with that? Thanks.

    • 0

      Reputation Points

    • 2 replies
    • 1.4k views
    • 1 follower
  20. Started by nazych,

    I made collier media yesterday consisting of all amino acids and also glucose and trace element. I want do growth the day after tomorrow and I am worried about my media not getting bad, I was wondering if i can put it in cold room for the time I dont use it? Thanks.

    • 0

      Reputation Points

    • 2 replies
    • 985 views
  21. I've designed an scFv against Indole acetic acid. I haven't got access to any lab equipment (this is a desk based project), so I've been told I have to use some kind of prediction software to see how well this scFv will bind. I've only designed the primary peptide sequence. How would I go about doing this? I would imagine I'd need some kind of programme that can show me how this peptide sequence I've made fits to Indole acetic acid. But I don't think it's possible to predict tertiary protein structure just from the peptide sequence. I've heard about PYMOL and some bioserf thing on UCL, but I really haven't got any experience using these things, and don't know what the…

    • 0

      Reputation Points

    • 2 replies
    • 1.2k views
  22. Started by charlieb,

    Greetings all: I'm just touring the relevant forums offering a chance to write a Genome Browser App I wrote. https://sites.google.com/site/chbelhumeur2000/ No not selling the app or looking for beta testers. It just works so well and I'm having so much fun exploring genomes I feel compelled to share. Thank any in advance for their interest in the app. Woops, I meant a chance to "try" not "write" the app I wrote. I'm having a lot of trouble with text entry in text boxes stalling lately. I write by looking at the screen and not the keyboard. This really messes me up. Is anyone else having this problem. Seems worse in Fireox than in Internet Explorer, b…

    • 0

      Reputation Points

    • 1 reply
    • 1.1k views
  23. Started by exec,

    we have sephadex g-25, sephadex g-50 and sephadex g-75 resins. our protein is 20 Kda and we would like to desalt it for further processing. Can some one recommend which of these will be suitable. i.e which will cause less dilution and better desalting. we would be packing them in XK 16/40 column and use for desalting so what amount of sample can be desalted at a time. kindly suggest thanks

    • 0

      Reputation Points

    • 2 replies
    • 1.7k views
  24. Basicly you would give a helping hand to summarice a list where in the internet is offer encyms and DNA (special for PMCR) - Methyltransferase - Decarboxylase - Demethylase nice greetings from the Austrian Alpine Area Sientist and Freerider

    • 0

      Reputation Points

    • 2 replies
    • 960 views
  25. i want to ask that in buffalo or bovine what disorders and diseases are associated with growth hormone receptor (GHR) or growth hormone binding protein (GHBP)? secondly the gene location of GHR of water buffalo is also needed along with the references. please can anybody help me out?

    • 0

      Reputation Points

    • 0 replies
    • 1.2k views
    • 1 follower

Important Information

We have placed cookies on your device to help make this website better. You can adjust your cookie settings, otherwise we'll assume you're okay to continue.

Account

Navigation

Search

Search

Configure browser push notifications

Chrome (Android)
  1. Tap the lock icon next to the address bar.
  2. Tap Permissions → Notifications.
  3. Adjust your preference.
Chrome (Desktop)
  1. Click the padlock icon in the address bar.
  2. Select Site settings.
  3. Find Notifications and adjust your preference.