Skip to content

Biochemistry and Molecular Biology

Discussion of protein structure, energetics, and molecular biology.

  1. The full question is: .Short DNA sequences consisting of guanine and cytosine base pairs only (poly-C,G DNA) adopt an anti-parallel, double-stranded helical structure in which the major grove is twice the width of the minor grove. Poly-A,T DNA forms a parallel, double-stranded helical structure in which the major and minor groves are of the same width. DNA containing both C,G and A,T base pairs adopts the same structure as poly-C,G. Discuss. I'm guessing it must have something to do with the way each pair hydrogen bonds, but I'm really not sure how this might go on to affect the secondary structure of the DNA so profoundly. Any hints or links to a good source wo…

    • 0

      Reputation Points

    • 0 replies
    • 1k views
  2. Hi, PagP, an integral outer membrane enzyme of e.coli I am working on, has been shown to control the cytoplasmic event of lipopolysaccharide biosynthesis when activated . From the structural details of PagP, it seems that three amino acid residues in the inner leaflet region are organise in the catalytic triad (they have superimopsable image with chymotrypsin catalytic triad). Now, we want to know whether these three residues are actually working as catalytic triad and doing the signal transduction. What reliable experiments can answer this question? Since, Outer membrane protein is affecting the cytoplasmic event that means there must be some proteins in periplasm and…

    • 0

      Reputation Points

    • 2 replies
    • 1.4k views
  3. Started by ivanovicl,

    Hi. Over the course of 12 weeks I have conducted a chemistry experiment for school on the effect that the auxin Indole-3-acetic-acid has on plant growth (tommy toe tomato plant). This is because IAA is meant to increase plant growth by promoting cell division, expansion etc. We also created a nutrient solution. However, I found that instead of increasing plant growth, yeast precipitates have formed within the solution taking all the nutrients from the plant and effectively killing it. My question therefore is this, in terms of chemistry, why is the addition of Indole-3-acetic-acid producing yeast?

    • 0

      Reputation Points

    • 2 replies
    • 1.5k views
    • 1 follower
  4. Started by NewSpiderman,

    I'm having a hard time finding any details regarding the differences between the genetic code within the nucleus and the mitochondria. There are some differences in the pairing of amino acids to codons, but does anyone know exactly why this is so? Are there different types of tRNA synthesized by each distinct genome which result in such disparities or is there another reason for these variations? Any information, especially some references, would be appreciated. Muchas gracias, peeps!

    • 0

      Reputation Points

    • 1 reply
    • 1.1k views
  5. Started by blazinfury,

    I was reading about how antibodies are something produced in animals for humans who are unable to synthesize them. However, I am confused about how scientists ensure that an immune reaction doesn't occur from the recipient? Are those antibodies modified somehow and/or is the animals modified as well to ensure that no immune reaction occurs. Thanks.

    • 0

      Reputation Points

    • 5 replies
    • 1.6k views
    • 1 follower
  6. Started by BabcockHall,

    Hello Everyone, Does anyone know how quickly the reagents for silver staining SDS PAGE gels for proteins go bad? We have a kit that is 3-4 years old. The kits are pricey, most likely due to the silver itself, so we would prefer not to replace it unless it is necessary. If one reagent is likely to go bad, can we just replace that one? We have experience in our lab with ordinary SDS PAGE, but silver staining is new to us.

    • 0

      Reputation Points

    • 1 reply
    • 1.3k views
  7. Started by F3nt0n,

    Hi guis, recently I ran for the first time a Western Blot + immunodetection analysis on few specific proteins and their antibodies; Beta-actine: 1°Mc Ms β-actin / 2°GAM-HRP PCNA: 1°Mc Ms PCNA / 2°GAM-HRP Occludine: 1°Pc Rb OCC / 2°GAR-biotin / 3°s-HRP I got the following results: http://s23.postimg.org/i0jea1oyz/Occludin.jpg http://s13.postimg.org/qg0r2ew2v/PCNA.jpg http://s15.postimg.org/flsazmwij/PCNA_b_actine.jpg http://s24.postimg.org/af5t0z0dx/Occludin_b_actine.jpg Since i'm quite new to this, I really wondered what those other lines were (beside the molecular ladder). The saturated lines are the proteins (of that I'm sure), but lighter ones are unknown to me. Al…

    • 0

      Reputation Points

    • 0 replies
    • 1.2k views
  8. I'm taking the ACS biochemistry II exam on monday. I took the ACS biochemistry I exam last semester. Our university is not ACS certified so technically we don't have to take it. But we do anyway and everyone always does bad. Last semester, our teacher made study guide. It didn't really help, so I wonder if any of you have taken the ACS biochemistry II exam. I know its over both sections of biochemistry, what do I have to know from the first section versus the second section? Know any good websites for studying for this exam? or just any tips to do well on this exam would be appreciated! I am a bit worried about this exam!

    • 0

      Reputation Points

    • 0 replies
    • 1.5k views
  9. Hi, I'll soon be doing a click chemistry reaction which calls for 10% of the reaction solution to be a 1M Tris buffer of pH 8.5. Assuming that I want 200ml of the buffer and use solid Tris with 1M HCl I would prepare in the following way: (See my calculation below) So I come up with: 24.23g Tris 68ml 1.0M HCl BTV 200ml with H2O Then titrate to pH 8.5. Questions: 1) Can I autoclave the buffer? 2) I really only need about 250ul of this Tris buffer per experiment run. Can I store the rest for future use and is room temp ok? or -4C, -20C, -80C? Calculations: 200ml of 1M Tris @ pH 8.5. & 1M HCl stock 200ml(1/103ml)(121.14g/mol) = 24.23g…

    • 0

      Reputation Points

    • 4 replies
    • 2k views
  10. Started by jakebarrington,

    How many atoms are there in the average human cell? Including all parts of the cell (lipid bilayer, nucleus, ribosomes, etc.)

    • 0

      Reputation Points

    • 3 replies
    • 1.7k views
  11. Started by blazinfury,

    I have a question about Thyroid hormone. I read that it acts like a lipid. So does that mean that it is like a steroid in terms of it traversing the plasma membrane and then being transported into the nucleus and acting directly on DNA? in addition, people say that steroids are long lasting and this is due to them acting directly on DNA. Are they long lasting because you cannot degrade them or turn them off inside of the nucleus? Then how do we control their level of expression by just creating inhibitors to degrade extra protein that they produce or via RNAi?

    • 0

      Reputation Points

    • 2 replies
    • 1.3k views
    • 1 follower
  12. I read in a book that if a protein is heated its 3 and/or 4 structure is denatured but upon cooling the protein will not be able to resume that conformation back. Is that true? I agree that if those bonds are broken there is no guarantee that those bonds can be reformed but wouldn't it depends on the type of protein, its size, and how many competing bonds there are in terms of determining if it can resume this structure?

    • 0

      Reputation Points

    • 5 replies
    • 1.4k views
    • 1 follower
  13. Hi guys. In my second year of study. This week we lernt about energy metabolism and I am confused about a few things. (1)Is thermogensis( which is basically heat production) the pathway in which adipocytes(adipose tissue/white fat) are oxidised which causes a release of ATP? Is this fat loss in a nutshell? (2) My lecturer said that de novo lipogenisis is not that significant in humans ; that we need 500+ surplus of carbohydrates to really initiate this biochemical process ?. What is the process in which we put on fat though? I’v read somewhere that lipogenesis is when acetyl-CoA is converted to fats and encompasses fatty acid synthesis and triglyceride synthesis ? …

    • 0

      Reputation Points

    • 1 reply
    • 986 views
  14. Started by MasterCobra,

    Hello, For my genetics class, I had to subclone LUX ABE into pUC18 in order to make E. coli glow in the dark with the addition of aldehyde. Unfortunately, I had star activity with the digestions, so it made it almost impossible to identify the LUX ABE band on my electrophoresis gel. My question is: if an enzyme produces cohesive ends in optimal conditions, will it continue to produce cohesive ends in star activity conditions? Or, will it turn to blunt ends? Thank you, Julien

    • 0

      Reputation Points

    • 2 replies
    • 1.2k views
  15. Is RNA present in the cytosol as double stranded structures? I know that tRNA can assume double stranded structure but isn't mRNA single stranded? I just want to make sure because I was reading about northern blots and it was states that formaldehyde agarose gel is used to separate the RNA bands specifically to denature RNA and stop it from assuming a self complementary structural shape. Or is formaldehyde used because some RNA assumes this shape and so to equilibrate the solution formaldehyde is used to ensure all RNA is single stranded. Would you deem this principle similar to how sds is used in sds page for protein?

    • 0

      Reputation Points

    • 1 reply
    • 1.6k views
    • 1 follower
  16. Started by mansipan,

    After designing a primer there are different purity grades available according to the purification protocols adopted like, desalting, reverse phase cartridge purification, RP-HPLC, AX-HPLC, PAGE and Gel filtration. my question is how much purity or which purification procedure of primers is good enough for amplifying a gene for cloning purpose.

    • 0

      Reputation Points

    • 5 replies
    • 2.8k views
  17. Started by manu26,

    Hello every one, I am designing primers for BRCA1 gene. I have two questions: 1. How can I find the stop codon for this gene. 2. what are the instruction I should be attention to when designing primers for this gene? Thank you for you help

    • 0

      Reputation Points

    • 1 reply
    • 1.4k views
    • 1 follower
  18. Hi, I'm an undergraduate student currently doing a one year research placement as part of my degree. According to recent literature, a cytokine I'm working with is cleaved into a more active form by at least two serine proteases, but cleaved and inactivated by a cysteine protease. In order to obtain a native source of the cytokine, I culture a human cell line and then lyse the cells using multiple freeze-thawing cycles (the cells do not secrete the cytokine in question). I've found that adding a universal protease inhibitor cocktail to the culture during the freeze-thawing process greatly reduces cleavage of the cytokine (shown by IP) and its activity (measured us…

    • 0

      Reputation Points

    • 2 replies
    • 1.3k views
  19. Hi everyone, I am conducting a bio-chemistry related experiment and I have been unable to understand a step which is commonly performed. My aim in this step is to apply a PEG silane layer. After immersing ITO slides in a PEG-concentration, the slides are incubated for 18 hours at a temperature of 60 degrees Celsius. Can you tell me why the incubation is performed? And why for 18 hours and at 60 degrees Celsius? Thanks in advance.

    • 0

      Reputation Points

    • 0 replies
    • 1k views
  20. Hi, I would need an acidic, totally volatile buffer for lyophilization of my protein. The pH should be 3.0. The best were an egzact recipe, and because the total volatility is necessery, I think it is not good if the adjusting happens with for example HCl.. At least after my opinion.. So, I would like to get only my protein after lyophilization. In the last time I tried to make an ammonium-acetate -acetic acid buffer, first I solved 3,9 g ammonium acetate in 300 ml water (I wanted to make 500 ml end-volume; 3,9 g ammonium-acetate gives 50 mM concentracion in 500 ml), then I added to it acetic acid to getting pH 3.0. But I had to add ~110 ml 97% acetic to pH 3.0, so "t…

    • 0

      Reputation Points

    • 2 replies
    • 9.1k views
  21. Started by solaeko1,

    Knowing that oxidised guaiacum’s molar absorption coefficient is e600nm = 2000 M-1cm-1 , calculate Vmax in terms of micromoles guaiacum / second (mmoles / s). Assay volume in cuvette: 4 ml Someone pleaseee help me

    • 0

      Reputation Points

    • 1 reply
    • 1.9k views
  22. Started by molecchemgrad,

    If a person were to eat an excessive amount of sugar over a long period of time what would happen metabolically and physiologically? I know that a large amount of acetyl coA would be produced after the glycolytic pathway, producing a large amount of citrate, but would this citrate inhibit the phosphofructokinase enzyme of glycolysis even though there is a great amount of glucose coming in that would favor the glycolytic pathway?

  23. Started by blazinfury,

    I understand that in terms of proteins, when one denatures them, they tend to assume the primary structure depending on which bonds were broken when the denaturing agent was used. However, what does denaturation mean in terms of DNA? Does it mean that the 2 strands are separated (ie breaking Hydrogen bonds b/w the bases) or does it have another meaning?

    • 0

      Reputation Points

    • 2 replies
    • 1.2k views
    • 1 follower
  24. Started by blazinfury,

    I am having trouble reading a Sanger Sequenced gel. I have tried to reason it out and would appreciate someone commenting about how I am approaching this. Thank you. When one does Sanger sequencing, the DNA strands are separated from each other and primers are used to sequence a portion of the DNA. Now, the template strand is used (and NOT the coding strand) in sequencing correct? If so, lets say that you have this gel below. If the gel is read bottom to top, you are reading 5' to 3' of the coding stranding, correct? So in this case, that would mean that the coding strand is: 5' ACGCCCGAGTAGCCCAGATT 3'. This strand is the complement of my template strand an…

    • 0

      Reputation Points

    • 1 reply
    • 5.4k views
    • 1 follower
  25. Started by mohamed samir,

    Dear ALl, Alittle bit stricky for me to ask question like this. Iam going to perform an experiment on a co- culture consists of both human A549 pneumocyte II cells and murine macrophage J774 cell line to test the effect of miRNAs on influenza virus replication . I have no protocol for this and iam confused really whether I will be able to blend two cell line from different host. However, the media in both cells are differ , is this will pe appropriate medium for both cells ? Should I used human macrophage cell line to be compatable with the A549 cell as it is from human ? Dpepnding on which criteria, will our biculture succeed ? I can summarize the question Can I cult…

    • 0

      Reputation Points

    • 1 reply
    • 1.9k views
    • 1 follower

Important Information

We have placed cookies on your device to help make this website better. You can adjust your cookie settings, otherwise we'll assume you're okay to continue.

Account

Navigation

Search

Search

Configure browser push notifications

Chrome (Android)
  1. Tap the lock icon next to the address bar.
  2. Tap Permissions → Notifications.
  3. Adjust your preference.
Chrome (Desktop)
  1. Click the padlock icon in the address bar.
  2. Select Site settings.
  3. Find Notifications and adjust your preference.