Biochemistry and Molecular Biology

Would 8 M urea brake up E. coli cells? If you had them in a pellet, used enough 8 M urea and only resuspended it?

I mean, lets assume theres no fat/oils/starches in the can. Isnt a 6 oz can of tuna 6 ozs of "protein, for practical considerations? Some doctor here is telling the wife its not true- that all shes getting is a fraction of that in "real" protein........

Hello everyone, This is my first post here. I am trying to purify artemisinin from an ethanolic extract of Artemisia annua (sweet wormwood), and I ran into the the typical problem encountered by biochemists doing this procedure: removing the plant waxes without losing artemisinin. Most of the literature I have come across recomends using petroleum ether or hexane to defat ethanolic plant extracts. This would not work in my case because artemisinin happens to be very soluble in both of those solvents (in fact, hexane is used for industrial-scale production of artemisinin). I read a tip somewhere about using molten parafin wax, but that just removes the fats (as far as …

For starters I have a relatively basic understanding of biochemistry and metabolic pathways, etc. I've been wondering, in order to build muscle you require a caloric surplus which in general means a greater generation of energy (ATP) in order to synthesize proteins to help with the repair of muscle damage in muscle cells. So IF I consume a shot of alcohol, it enters into my body and is rapidly converted to acetate through a number of metabolic pathways. Now if acetate is converted to acetyl-CoA (which in the end can result in either fat synthesis or ATP synthesis) and I am in a state of required energy, acetyl coa is going to be used in the process of ATP synthesis. As a …

Im new to these forums so hello to everyone here! I hope im posting in the right place about this subject? So im not very scientifically knowledgeable so my simple searches online are not resolving my curiosity :/ so i figured ill just ask the right people! so.... 1. Is the ONLY gas needed for leaves co2? 2. Is the ONLY gas needed for roots o2? 3. For both gases above if I were to mix them with a gas to get the right concentration, what gas would have no effect on the growth/chemistry and be easy to obtain? Next im curious as to the general gas concentrations needed for roots/leaves. If this is a stupid question then please feel free to use a…

hi all, have anyone ever tried to determine Tryptophan in high yields from protein hydrolysis ? I've read many experiments sheets indicating destroying of Trp by acid hydrolysis. and many alkaline hydrolysis will lead to a best 80% Trp protection. I really don't wanna waste assets on failure. any help on what can i do will be greatly appreciated.

I've got some predcited protein structures, and I want to see how well they match against another one from the Protein Databank. See the attached files. I-TASSER and EsyPred3D and predict protein were all used. What I designed was an ScFv, and now I need to see how similair it is to something else. I have no idea what I;m doing other than that. The text document is the peptide sequence I designed. Any help appreciated.. I-TASSER results for your_protein.zip ESyPred3D.zip sequence (bad areas removed).txt

This should be a fun one! Does mineral oil prevent excretion of toxins from skin? I know we excrete toxins from the skin, but that's after toxins are processed by the liver, kidneys and intestinal tract. I don't know the respective percentages of toxins dealt with by each organ (if you do, please share) , but I think it indicates you're most likely to excrete your toxins via urination and feces rather than via sweat. I also know that mineral oil is used on the skin of ocean swimmers to prevent chill and that mineral oil is digested to aid with constipation because it coats the intestinal track, allowing for re-hydration of feces (oh yay!). Anyway, can anyo…

Hi, I've been trying to run gels for a series of PCRs to test primers. However the bands so far have been curvy, slanted and very unclear. I then tested a 100bp and 1kb marker in a gel I made to check that the error is from the gel electrophoresis and not the PCR. A similar problem occured however, and I can't seem to figure out what is wrong. I'll attach both pictures. The first gel was run at 80V and is a 3% gel. The second gel is also 3% and it was run at 90V. The third gel is 2% run at 100V. If anyone has any ideas on what to fix that would be great. Thanks!

Hello, I have two proteins which one is wt protein, and one is mutant of the same protein. I should denature both proteins in the same conditions with 5 M urea and do NMR on both of them and they should be exactly in the same conditions. I already used protoparam tool in expasy and found the extinction coefficient of mutant and is smaller than wt, but when I denatured the protein and did NMR on them, the NMR spectrum of mutant dropped about 30%, but based on expectation, it should only drop about 15 percent. I have a problem to find their exact concentration. Can you please give me a way to calculate extinction coefficient of the mutant and wt. Thanks.

i want to test my RNA purity. i orders a sequence and i think it's also contain other sequence with the same length, please help me , how to evaluate the purity?

Dear all, First of all I have to say that I am not really experienced with cells and proteins isolation. My question is that I wanna isolated Histone H1 from a type of cells. There are a lot of reports, but all of them used acidic conditions (perchlorid acid, sulfuric acid, trichloroacetic acid...) and thats something that I would like to avoid. In some of the cases I understand that such conditions are used to precipitate the proteins and in others I guess that are to break/lyse the cell membrane nucleus. Are u aware of any method to isolate proteins from the nucleus avoiding acidic conditions? And second question, why such acids are being used to isolated such prote…

I am trying to use beta Estradiol as a compound to test in cell culture, and it is only dissolvable in ethanol, and whenever I try to carry out serial dilutions to carry out the dilution to nanomolar levels, the hormone seems to come out of solution rapidly. Any pointers/tips/advice for a grad student in need?

Hi, I just received the sequencing lists for my unknown bacterial. There are 5 unknown bacteria that I need to identify. I would like to identify the bacteria using blastn and construct phylogenetic tree using neighbor joining. Can anyone help me how to do it, since I not sure and familiar with it. Please help me as fast as possible. Thanks. Below are the lists of my sequencing results. >1st_BASE_1215970_B_subtilis_168_Bacillus_Family_F.ab1 GGATTTCATATATTCGTCCTACAGCTAGCGTCATTGGAACTGGCATGTAAACTGGGATACCTCCGGGAAACCGGGGCTGA TACCGGATGGTGGTTTAAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCACTTACAGATGGACCCGCGGCGCA TTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGATGCGTAGCCGACC…

Hi, We have an amsco lab 250 autoclave in our department. When yesterday I wanted to autocalve my flasks for growing bacteria, i saw it was saying "all utility shut down" i hit cancel on the screen and did autoclave. Today when i tried to autoclave and hit cancel it went to main menu and i choosed my option, but it did not start to autoclave and again it went to "all utility shut down" and when i hit cancel again it did not do anything and emained shut down, it seems touch screen does not do anything. Can some body help me with that? Thanks.

I made collier media yesterday consisting of all amino acids and also glucose and trace element. I want do growth the day after tomorrow and I am worried about my media not getting bad, I was wondering if i can put it in cold room for the time I dont use it? Thanks.

I've designed an scFv against Indole acetic acid. I haven't got access to any lab equipment (this is a desk based project), so I've been told I have to use some kind of prediction software to see how well this scFv will bind. I've only designed the primary peptide sequence. How would I go about doing this? I would imagine I'd need some kind of programme that can show me how this peptide sequence I've made fits to Indole acetic acid. But I don't think it's possible to predict tertiary protein structure just from the peptide sequence. I've heard about PYMOL and some bioserf thing on UCL, but I really haven't got any experience using these things, and don't know what the…

Greetings all: I'm just touring the relevant forums offering a chance to write a Genome Browser App I wrote. https://sites.google.com/site/chbelhumeur2000/ No not selling the app or looking for beta testers. It just works so well and I'm having so much fun exploring genomes I feel compelled to share. Thank any in advance for their interest in the app. Woops, I meant a chance to "try" not "write" the app I wrote. I'm having a lot of trouble with text entry in text boxes stalling lately. I write by looking at the screen and not the keyboard. This really messes me up. Is anyone else having this problem. Seems worse in Fireox than in Internet Explorer, b…

we have sephadex g-25, sephadex g-50 and sephadex g-75 resins. our protein is 20 Kda and we would like to desalt it for further processing. Can some one recommend which of these will be suitable. i.e which will cause less dilution and better desalting. we would be packing them in XK 16/40 column and use for desalting so what amount of sample can be desalted at a time. kindly suggest thanks

Basicly you would give a helping hand to summarice a list where in the internet is offer encyms and DNA (special for PMCR) - Methyltransferase - Decarboxylase - Demethylase nice greetings from the Austrian Alpine Area Sientist and Freerider

i want to ask that in buffalo or bovine what disorders and diseases are associated with growth hormone receptor (GHR) or growth hormone binding protein (GHBP)? secondly the gene location of GHR of water buffalo is also needed along with the references. please can anybody help me out?

The full question is: .Short DNA sequences consisting of guanine and cytosine base pairs only (poly-C,G DNA) adopt an anti-parallel, double-stranded helical structure in which the major grove is twice the width of the minor grove. Poly-A,T DNA forms a parallel, double-stranded helical structure in which the major and minor groves are of the same width. DNA containing both C,G and A,T base pairs adopts the same structure as poly-C,G. Discuss. I'm guessing it must have something to do with the way each pair hydrogen bonds, but I'm really not sure how this might go on to affect the secondary structure of the DNA so profoundly. Any hints or links to a good source wo…

Hi, PagP, an integral outer membrane enzyme of e.coli I am working on, has been shown to control the cytoplasmic event of lipopolysaccharide biosynthesis when activated . From the structural details of PagP, it seems that three amino acid residues in the inner leaflet region are organise in the catalytic triad (they have superimopsable image with chymotrypsin catalytic triad). Now, we want to know whether these three residues are actually working as catalytic triad and doing the signal transduction. What reliable experiments can answer this question? Since, Outer membrane protein is affecting the cytoplasmic event that means there must be some proteins in periplasm and…

Hi. Over the course of 12 weeks I have conducted a chemistry experiment for school on the effect that the auxin Indole-3-acetic-acid has on plant growth (tommy toe tomato plant). This is because IAA is meant to increase plant growth by promoting cell division, expansion etc. We also created a nutrient solution. However, I found that instead of increasing plant growth, yeast precipitates have formed within the solution taking all the nutrients from the plant and effectively killing it. My question therefore is this, in terms of chemistry, why is the addition of Indole-3-acetic-acid producing yeast?

I'm having a hard time finding any details regarding the differences between the genetic code within the nucleus and the mitochondria. There are some differences in the pairing of amino acids to codons, but does anyone know exactly why this is so? Are there different types of tRNA synthesized by each distinct genome which result in such disparities or is there another reason for these variations? Any information, especially some references, would be appreciated. Muchas gracias, peeps!