Homework Help

Please help me solve the last question!! Thank you so much!!

Okay so I have to add CH2NMe2 to benzene ring with with OH's at positions 1 and 2 and a tertbutyl at 4

I have 1 DNA sequence in 3 separate pieces from which some bases aren't clear. The 3 sequences are: 5’ AGATGAAAACTCTGCTGCTGACCTTGGTGGTGGTGACAATTGTGTGCCTGGACTTAG GATACACCTTAAAATGTCACAACACACAGNTTNNNNNCANCNATRRRR 3’ 5’ NNNRAYRTNNNGRTRATTGCCCTAAAAACAGTGCCCTATTGAAGTATGTGTGTTGCA GCACAGACAAATGCAACTGATAGCTCTACGAGTGGCTAAATTCGCTGAG 3’ 3’ NTNNYANARRYYNCNYTNATAGTCGTGTAGGGGAAAACTGTCCTTTAAAGTTACCTTT GAAGGAGTTTCAGCGAAATTTCGTATTCAAGAAGGGAAGACCTGTTCAGAATAGAANATCTATTTCCNNCGNNAYRNANN 5’ The letters locate the following bases: N = A, C, G, T Y = T, C R = A, G I need to know the DNA sequence completely, and if possible the Amino-Acid sequence of it. Thank Yo…

I realize that if the reactants give off heat when they undergo reactions it is exothermic and when they absorb heat it is endothermic, but how can I tell by looking at an equation whether or not it is going to be endothermic or exothermic. Do the states of the reactants have anything to do with it? ex/ MgO(s) + 2HCl(aq) -> MgCl2(aq) + H2O (l) the oxygen atoms are more tightly packed with the Magnesium, so when they join with the hydrogen ions to form liquid water they must have more space to move, meaning the thermal energy of the products are higher than of the reactants, so why is it still exothermic?! A lot of people have told me its simply becaus…

Does anyone have any C experience?

1.A mass of 5kg of Saturated water vapor at 300 kPa is heated at constant pressure until the temperature reaches 200C. calculate the work done during the process. 2.Steam enters a nozzle at 350C and 800 kPa with a velocity of 15 m/s, and leaves at 250C and 200 kPa for an inlet area of 750 cm^2. Determine the velocity of the steam at the nozzle exit. This is the type of problems that will go out my exam. please help me answer this problem so i can study and understand this problem.

is there any way in which i can make a graph in excel and count by "x.yz" like 1.20? I did a titration in my quantitative analysis lab and we are suppose to make a graph and we had to titrate by 0.05 mLs near equivalence point. So my graph instead of being, "1,1.50,2.00,2.50" is made in excel as "1,2,3,4" for each value. Does this make sense? Also, is anyone familiar with potentiometric titrations? I'm a little unsure what to do with my calculations.

I'm new to the forum, and believe it or not, I love organic chemistry. I'm not the best at it, but I really enjoy the subject. That said, we were given a homework assignment with 5 questions (due later tomorrow), and we are allowed to use any resources we want. Well, there are about 2 of the 5 that I just have no clue for, and for the other 3 I was hoping to have my work checked. 3 synthesis, 1 predict the acidity from values in a table, 1 predict the acidity between 3 cyclic compounds. Can anyone on here help me? I'd be willing to even possibly paypal money for the help. I am not just asking for answers, but assistance for me to get the correct answer. This …

Hello, I have seen 2 kind of "lewis notations" for molecules, I will give an example: Is there anyone on this forum who is well familiar with the second notation? I Dont see any formal charge next to the S and other 2 O's, does that mean that the formal charges of S and the 2 O's are zero? Now if that is true im very confused then, because the first notation has 2+ as formal charge for S!! How is that possible? Im really confused here, could someone please help me out? Thanks in advance!!

Solve: log5(x-1) + log5(x-2) - log5(x+6) = 0 I feel like this is really simple but I cannot get the answer. This is what I attempted Since they have the same base, I multiplied the top log5[(x-1)(x-2)] - log5(x+6) = 0 This gives me log5(x2-3x+2) - log5(x+6) = 0 At this point I did not now what to do, I tried 2 methods, 1. Since they are the same base again, I divided the top this time log5(x2-3x+2) / (x+6) = 0 but I don't know how to continue 2. I moved - log5(x+6) to the other side log5(x2-3x+2) = log5(x+6) Since they have the same base I ignored them so x2-3x+2 = x+6 Which gave me x2 - 4x - 4 Which cannot be factored. Please help, thankyou

Hi, I am working on an assignment for my CSC class and I am having trouble with the code. I have an idea on what I would like to do. The purpose of the assignment is to make a simple game of craps. First time you roll if you land on a 7 or 11, you win automatically. If you roll on 2, 3, or 12, automatic loss. Anything else keep rolling until you and on a 7, then you automatically lose. If you can look at my code and let me know what you think of it, I truly appreciate it. // JavaScript source code // First going to create the bet function function BtnBet_onclick() { //create variables var die1; var die2; var rolls = 1; var bet = documen…

Q: Write the balanced net ionic equation for the complete neutralization of aqueous citric acid by sodium hydroxide, taking careful note of the number of carboxylic acid groups in the structure. A: I know that the beginning of the formula should be: C6H8O7(aq) + NaOH(aq) ---> but I don't know how to go about finding the reaction. Why do I need to take note of the carboxylic acid groups?

Hi all .. Here I have two questions .. could please help how I can solve that give me idea , and can please clear out the meaning of question ? question number 1 question number 2

A train starts from rest from a station and travels with uniform acceleration 0.5m/s^2 for 20s. it travels with uniform velocity for another 30s, the brakes are then applied so that a uniform retardation is obtained and the train comes to rest in a further 10s. sketch the velocity-time graph of this motion. Using your graph, calculate the total distance travelled by the train Please include explanations...thanks.

Hello! I'm in a competition, in which on saturday, I'll have to answer a few questions related to biochemistry and genetics. I would like to ask help from a biochemist to answer these questions.

Hi, The Question: For 1dm cubed of a gas in normal conditions with a mass of 2.86g, calculate the average relative molecular mass and density at 17C and 207kPa Please explain to me the method of solving this. My working for the average relative molecular mass: M=mPV/RT M= 2.86x207x1/8.314x290 M= 0.2455g/mol Mr=0.2455 This however is not correct, as the answer in the textbook is 64.1 Thanks.

How can i determine which element is a stronger reducing agent? I have a homework problem that ask if Fe is a stronger reducing agent then Cu. How does one determine this?

Suppose that A be subsets, let F={f|f:A→A} and P={f є F|f is bijective}.Define a relation as follows R={(f,g) є F X F | Ǝ h є P (f= h-1 o g composition h (g∙h)) and prove that R is an equivalence relation P= partition

What is the total mass of a solution? Given, a solution contains 1.60 g of solute in 12.9 g of solvent. This may seem like a silly question, but what equation needs to be used to find this answer? Thank you! Figured it out. (Mass percent equation)

Our professor gave us this homework to solve and I was wondering if someone could just tell me if the answer is correct or not because one of my friends told me there were "mathematical and scientific" issues with the way I solved the equation or the numbers I used The homework and Excel file which includes the graph is in this link. I apologize for the messiness, lack of scientific language and probably not being clear in some parts but this is a very rough draft, I just need to know if what i solved is correct since my friend's remark made me doubt everything I did. Thank you very much in advance

I am currently stuck on this problem Complete the following method that determines if two chains of nodes are equal, that is, they have the same strings in the same order. Note two empty chains are considered equal. public static boolean equals(Listnode<String> chain1, Listnode<String> chain2) { I do not understand how i am supposed to compare the two chians without being able to use an index like you can for arrays. ANy help would be greatly apprciated

Hi Here is a question with answer , in fact I don't understand the answer fully .. please can explain to me the answer .. pleas anyone clear out the answer and here in answer I saw that work is negative is that because work done by the system ? The question : - solution : -

Hi How are you I have a question how we can know the work if - or + also heat energy please could see this question why in answer take work as - and heat as +

Hello I'm confused as to how to do this question. 4^x + 6(4^-x) = 5 I was thinking of changing 4^x to a variable like 'a' so it would be easier to work with, but 4^-x is not the same so I can't replace that with 'a' as well. Then I though 4^-x = 1/4 ^x So 4^x + 6[(1/4)^x] = 5 But i have no idea where I'm going with this and I'm lost. Please help, thanks

log52 (x-3) = x One of my friends came up with this equation and asked me to graph it. I haven't seen an equation like this, and do not know how to graph using mapping notation or any other methods. Is it possible to graph this? Looking at the equation, I would assume that there can only be one answer to this because log52 can only have one answer since this means that 5x = 2 Can someone please point me in the right direction? Thanks you