Homework Help

Q1 - Using more than one letter and powers .: Online homework:. Work out the value of these expressions. 9(p - q) when p = 14 and q = 6 2ab + 6c when a = 3, b = 2 and c = 9 92 - tuv when t = 3, u = 7 and v = 4 r st when r = 96, s = 3 and t = 4 a 28 - b when a = 72, and b = 8 2 3m When m = 3 2 2 54 - 3s + t when s = 3 and t = 6 Q2 - Using Negatives Work out the value of these expressions. pgr when p = -3, q = 4 and r = -5 -5(a - b) when a = 2 and b = -4 2 4s - st when s = -3 and t = -6 5c - d…

Hello everyone In math class, we've proven something that had to do something with tha tangent of a hyperbola: the tangent point P is the middle point of [QR] with Q the intersection of the tangent and one assymptote, and R the intersaction of the tangent with the other assymptote. After we've calculated the values for: [math]Q\left( \frac{a\cdot\cos{t}}{1-\sin{t}};\frac{b\cdot\cos{t}}{1-\sin{t}} \right)[/math] [math]R\left( \frac{a\cdot\cos{t}}{1+\sin{t}};\frac{-b\cdot\cos{t}}{1+\sin{t}} \right)[/math] [math]P\left( \frac{a}{\cos{t}};b\cdot\tan{t} \right)[/math] we started expressing that P is middle of [QR], and getting an equality. However:…

Can you help define these problems? 1) 1972: Assembly-line workers 2) Proletariat 3) Lumpen Proletariat 4) Bourgeoisie 5) Horricutural society

Ok i know this is a very basic question the difference of m.p and b.p. of iron(ii)chloride and iron(iii)chloride. But what is the exact reason? is it because of their hybridizations? (sp and sp2 rspctvly) or is it because the ionization potential of Fe3+ is a lot more than Fe2+ ? . Please help. Nd thnx in advanec

I've got this assignment and it states that we can't use any methods that involve creating a library of cDNA clones, but is based on RT-PCR (Reverse Transcription – Polymerase Chain Reaction). The only thing we know is the mature protein sequence. How do I design a primer that is specific to the mRNA?

Please can anyone help me solve this? 1. As an example, consider a two-level cache in which the L1 hit time is 5 ns, the L2 hit time is 20 ns, and the L2 miss time is 100 ns. There are 10,000 memory references of which 10 causes L2 misses and 90 causes L1 misses. Compute the hit ratios of the L1 and L2 caches and the overall effective access time 2. Write an assembly language program, which adds three numbers and stores the result at ADD. The numbers are defined at three consecutive locations

A Quality Analyst wants to construct a control chart for determining whether four machines, all producing the same product, are under control with regard to a particular quality attribute. Accordingly, she inspected 1,000 units of output from each machine in random samples, with the following results: 23/1000 15/1000 29/1000 13/1000 What is the estimate of the standard deviation of the sampling distribution of sample proportion for whenever this process is under control? I used the formula for standard deviation for population samples and it didn't give me the right answer. I think the answer was 0.0044. I have no idea how they got there.

I need help on this question for my test. So in homologous recombination, you have 2 double stranded DNA in close proximity. Lets say the top chromosome has 5 repetitive sequences right after another, and the homologous chromosome below it has the same 5 sequences. These sequences are about 500 base pairs long. Let's say there is a DNA break on the third sequence set on the top strand. Then, homologous recombination, crossing over, non-crossovers, and other mechanisms will occur. Explain a reason that would result in overall 7 repeats of the sequence on the top strand and 5 still on the bottom strand. Any help would be appreciated. Thanks. Here is a visualiza…

my lecturer give this assignment for 2 weeks. and i don't have any idea about the logic. can anybody help me, please?

This should essentially be an effusion-rate problem. I know the equation is [math]\dfrac{r_x}{r_y}=\sqrt{\dfrac{M_y}{M_x}}[/math], where [math]r[/math] is the rate of effusion and [math]M[/math] is molar mass. I know [math]M_{Ar}=39.95[/math] g and the effusion rate for arsenic(III) sulfide is [math]r=.28r_{Ar}[/math]. Therefore, [math]\dfrac{r_{Ar}}{0.28r_{Ar}}=\sqrt{\dfrac{M}{39.95g}}[/math]. I'm trying to find [math]M[/math]. After the math, I get [math]M=509.6[/math] g (to 4 significant figures). The closest working ratio for the arsenic compound seems to be two formula units, As4S6. This is the textbook answer. However, this molar mass is [math]492.04…

Pls can someone tell me how to calculate the resonant frequency of a short circuited loop of wire in terms of (1)distributed inductance and capacitance(2) in terms of conductor length and electrical speed.thanks for any help available

Imagine you want to do some functional tests on some resistant mutants. To aid you in this you use a set of old-fashioned F’ plasmids that carry various parts of the chromosome How could you construct a merodiploid strain that is heterozygous for your mutations (sequenced above)? Remember: every move you make requires a positive selection. How could you determine whether your mutation is dominant or recessive? What could you say about the protein whose alteration caused resistance?

Hello, I have been struggling with this program for a while and was wondering if anyone could help. I am trying to make a program where the user inputs an int 0-9 and then it will print out something like this: if user input=1 if user input = 3 I hope you guys get what im trying to say. so far i have: 1 **1 *21 321 import java.util.Scanner; public class Lab07 { public static void main(String[] args) { Scanner stdIn = new Scanner(System.in); int x; System.out.println("Enter a number 1-…

10.00 mL aliquot of a triprotic acid is reacted with 27.42 mL 0.168M KOH solution. Determine the molar mass of the acid. I'm not sure how can I find the mass of the acid, because I don't see anything mass-related to the acid. And also, does the "aliquot" affect anything?

Hi, I need to integrate the following function: f(x) = 1/x2 * e1/x Where x does not equal 0. Determine a number a < 0 such that: The integral of a till 0 f(x)dx = f(a) What the question aks is on other words: Find a number a, such that the number a equals the surface under the graph and its position on the x-axis. All that remains for me is to determine the integral of the function, I have tried integration by parts, substitution with u = e1/x , and improper intergrals, but none seemed to work. (I was working in loops, or making the integral even more difficult) Can someone help me in the right direction?

Can you PLEASE help me in making a high quality investigation plan.. For the following question .. 'Will protease be able to work in the mouth'

I have a multiplier circuit that multiplies a 2-bit number(0-3) with a multiplier factor of, 0, 1 or 2, ignoring 3 (not interested in result) So I have my truth table made and I understand everything about the question except the actual circuit. Asides from the "Don't care" answers, would I count every non-zero product to be 1? Thanks!

Hi, Can anyone please show me how do i use the time evolution operator (V) applied on the ground state [g> and getting the same result as in the image below? i need to show the explicit calculation.. taken from - from Cirac & Zoller, Quantum Computations with Cold Trapped Ions Thanks!!

A glass bulb contains air at room temperature and at a pressure of 1 atmosphere. It is placed in a chamber filled with helium gas at 1 atmosphere and at a room temperature. A few months later, the experimenter happens to read in a journal article that the particular glass of which the bulb is made is quite permeable to helium, although not to any other gases. Assuming that equilibrium has been attained by this time, what gas pressure will the experimenter measure inside the bulb when he goes back to check? I know I need to assume that the chamber volume is much greater than the bulb volume and to consider the number of states available to helium and its particle d…

Please help me solve the last question!! Thank you so much!!

Okay so I have to add CH2NMe2 to benzene ring with with OH's at positions 1 and 2 and a tertbutyl at 4

I have 1 DNA sequence in 3 separate pieces from which some bases aren't clear. The 3 sequences are: 5’ AGATGAAAACTCTGCTGCTGACCTTGGTGGTGGTGACAATTGTGTGCCTGGACTTAG GATACACCTTAAAATGTCACAACACACAGNTTNNNNNCANCNATRRRR 3’ 5’ NNNRAYRTNNNGRTRATTGCCCTAAAAACAGTGCCCTATTGAAGTATGTGTGTTGCA GCACAGACAAATGCAACTGATAGCTCTACGAGTGGCTAAATTCGCTGAG 3’ 3’ NTNNYANARRYYNCNYTNATAGTCGTGTAGGGGAAAACTGTCCTTTAAAGTTACCTTT GAAGGAGTTTCAGCGAAATTTCGTATTCAAGAAGGGAAGACCTGTTCAGAATAGAANATCTATTTCCNNCGNNAYRNANN 5’ The letters locate the following bases: N = A, C, G, T Y = T, C R = A, G I need to know the DNA sequence completely, and if possible the Amino-Acid sequence of it. Thank Yo…

I realize that if the reactants give off heat when they undergo reactions it is exothermic and when they absorb heat it is endothermic, but how can I tell by looking at an equation whether or not it is going to be endothermic or exothermic. Do the states of the reactants have anything to do with it? ex/ MgO(s) + 2HCl(aq) -> MgCl2(aq) + H2O (l) the oxygen atoms are more tightly packed with the Magnesium, so when they join with the hydrogen ions to form liquid water they must have more space to move, meaning the thermal energy of the products are higher than of the reactants, so why is it still exothermic?! A lot of people have told me its simply becaus…

Does anyone have any C experience?

1.A mass of 5kg of Saturated water vapor at 300 kPa is heated at constant pressure until the temperature reaches 200C. calculate the work done during the process. 2.Steam enters a nozzle at 350C and 800 kPa with a velocity of 15 m/s, and leaves at 250C and 200 kPa for an inlet area of 750 cm^2. Determine the velocity of the steam at the nozzle exit. This is the type of problems that will go out my exam. please help me answer this problem so i can study and understand this problem.