JPPanama Posted October 12, 2013 Share Posted October 12, 2013 I have 1 DNA sequence in 3 separate pieces from which some bases aren't clear. The 3 sequences are: 5’ AGATGAAAACTCTGCTGCTGACCTTGGTGGTGGTGACAATTGTGTGCCTGGACTTAG GATACACCTTAAAATGTCACAACACACAGNTTNNNNNCANCNATRRRR 3’ 5’ NNNRAYRTNNNGRTRATTGCCCTAAAAACAGTGCCCTATTGAAGTATGTGTGTTGCA GCACAGACAAATGCAACTGATAGCTCTACGAGTGGCTAAATTCGCTGAG 3’ 3’ NTNNYANARRYYNCNYTNATAGTCGTGTAGGGGAAAACTGTCCTTTAAAGTTACCTTT GAAGGAGTTTCAGCGAAATTTCGTATTCAAGAAGGGAAGACCTGTTCAGAATAGAANATCTATTTCCNNCGNNAYRNANN 5’ The letters locate the following bases: N = A, C, G, T Y = T, C R = A, G I need to know the DNA sequence completely, and if possible the Amino-Acid sequence of it. Thank You! JPPanama Link to comment Share on other sites More sharing options...
imatfaal Posted October 12, 2013 Share Posted October 12, 2013 JP - this is the homework help forum - not the homework solution. You need to show what you have attempted and members will prod you in the correct direction or confirm that you are already right. By eyeballing it I reckon I can reconstruct the full strand - what do you know about how the fragments must reallign ie how many ways -(ignoring base pair matches at present) can the strands be fitted. Link to comment Share on other sites More sharing options...
JPPanama Posted October 12, 2013 Author Share Posted October 12, 2013 JP - this is the homework help forum - not the homework solution. You need to show what you have attempted and members will prod you in the correct direction or confirm that you are already right. By eyeballing it I reckon I can reconstruct the full strand - what do you know about how the fragments must reallign ie how many ways -(ignoring base pair matches at present) can the strands be fitted. The problem is, at the moment I have completely no idea how to start solving this. This is the first time I came across this kind of thing. Link to comment Share on other sites More sharing options...
imatfaal Posted October 12, 2013 Share Posted October 12, 2013 OK hint one - try searching on "dna fragment" "dna end" and "dna base pairs" Link to comment Share on other sites More sharing options...
JPPanama Posted October 12, 2013 Author Share Posted October 12, 2013 OK hint one - try searching on "dna fragment" "dna end" and "dna base pairs" I have been searching this until now and I have not got any further. Please help. Link to comment Share on other sites More sharing options...
CharonY Posted October 12, 2013 Share Posted October 12, 2013 (edited) Think in these terms: - you have the info of two strands. Can one be used to figure out the sequence of the other? - If you have the complete sequence, how would you translate it into the amino acid sequence? - In order to re-assemble something from fragments, what do you need to know the order that they appear? Edited October 12, 2013 by CharonY 1 Link to comment Share on other sites More sharing options...
JaydenAdams Posted October 18, 2013 Share Posted October 18, 2013 An amino acid sequence is simply the order of these units in a polypeptide chain. In the case of proteins, the sequence determines the molecule’s three-dimensional structure, which in turn is crucial to the protein’s function. The sequences of amino acids in the proteins found in a living organism are coded in that organism’s DNA. Link to comment Share on other sites More sharing options...
Phi for All Posted October 19, 2013 Share Posted October 19, 2013 An amino acid sequence is simply the order of these units in a polypeptide chain. In the case of proteins, the sequence determines the molecule’s three-dimensional structure, which in turn is crucial to the protein’s function. The sequences of amino acids in the proteins found in a living organism are coded in that organism’s DNA. Source: http://www.wisegeek.org/what-is-an-amino-acid-sequence.htm ! Moderator Note Please give a citation link to the source when copy/pasting the work of others. Otherwise it looks like plagiarism, which is against the rules you agreed to when you joined. Link to comment Share on other sites More sharing options...
Recommended Posts
Create an account or sign in to comment
You need to be a member in order to leave a comment
Create an account
Sign up for a new account in our community. It's easy!
Register a new accountSign in
Already have an account? Sign in here.
Sign In Now