Skip to content

I need some help

Featured Replies

I have 1 DNA sequence in 3 separate pieces from which some bases aren't clear. The 3 sequences are:

5’ AGATGAAAACTCTGCTGCTGACCTTGGTGGTGGTGACAATTGTGTGCCTGGACTTAG GATACACCTTAAAATGTCACAACACACAGNTTNNNNNCANCNATRRRR 3’

 

5’ NNNRAYRTNNNGRTRATTGCCCTAAAAACAGTGCCCTATTGAAGTATGTGTGTTGCA GCACAGACAAATGCAACTGATAGCTCTACGAGTGGCTAAATTCGCTGAG 3’

 

3’ NTNNYANARRYYNCNYTNATAGTCGTGTAGGGGAAAACTGTCCTTTAAAGTTACCTTT GAAGGAGTTTCAGCGAAATTTCGTATTCAAGAAGGGAAGACCTGTTCAGAATAGAANATCTATTTCCNNCGNNAYRNANN 5’

 

The letters locate the following bases:

N = A, C, G, T

Y = T, C

R = A, G

 

I need to know the DNA sequence completely, and if possible the Amino-Acid sequence of it.

 

Thank You!

JPPanama

JP - this is the homework help forum - not the homework solution. You need to show what you have attempted and members will prod you in the correct direction or confirm that you are already right.

 

By eyeballing it I reckon I can reconstruct the full strand - what do you know about how the fragments must reallign ie how many ways -(ignoring base pair matches at present) can the strands be fitted.

  • Author

JP - this is the homework help forum - not the homework solution. You need to show what you have attempted and members will prod you in the correct direction or confirm that you are already right.

 

By eyeballing it I reckon I can reconstruct the full strand - what do you know about how the fragments must reallign ie how many ways -(ignoring base pair matches at present) can the strands be fitted.

 

The problem is, at the moment I have completely no idea how to start solving this. This is the first time I came across this kind of thing.

  • Author

OK hint one - try searching on "dna fragment" "dna end" and "dna base pairs"

I have been searching this until now and I have not got any further. Please help.

Think in these terms:

- you have the info of two strands. Can one be used to figure out the sequence of the other?

- If you have the complete sequence, how would you translate it into the amino acid sequence?

- In order to re-assemble something from fragments, what do you need to know the order that they appear?

Edited by CharonY

An amino acid sequence is simply the order of these units in a polypeptide chain. In the case of proteins, the sequence determines the molecule’s three-dimensional structure, which in turn is crucial to the protein’s function. The sequences of amino acids in the proteins found in a living organism are coded in that organism’s DNA.

An amino acid sequence is simply the order of these units in a polypeptide chain. In the case of proteins, the sequence determines the molecule’s three-dimensional structure, which in turn is crucial to the protein’s function. The sequences of amino acids in the proteins found in a living organism are coded in that organism’s DNA.

 

Source: http://www.wisegeek.org/what-is-an-amino-acid-sequence.htm

 

!

Moderator Note

Please give a citation link to the source when copy/pasting the work of others. Otherwise it looks like plagiarism, which is against the rules you agreed to when you joined.

Archived

This topic is now archived and is closed to further replies.

Important Information

We have placed cookies on your device to help make this website better. You can adjust your cookie settings, otherwise we'll assume you're okay to continue.

Account

Navigation

Search

Search

Configure browser push notifications

Chrome (Android)
  1. Tap the lock icon next to the address bar.
  2. Tap Permissions → Notifications.
  3. Adjust your preference.
Chrome (Desktop)
  1. Click the padlock icon in the address bar.
  2. Select Site settings.
  3. Find Notifications and adjust your preference.