alan2here

Derren Brown appeared on English TV today on Freeview channel 4 (and I think it's the same on Virgin and Sky). The program covered much but the item of most awe to me was when he supposedly showed an audiance and the viewers a video that made half of them stick to there chair so they couldn't get up for a while. He said he thought due to not ideal viewing conditions at home the number would be much less. He revealed methods he used and ones he didn't although this didn't reveal much. Before the video and once eairler in the show when he was descussing the idea were flashes, verry quick such that I couldn't really tell what they were but apeared to be inkings of somone tied up in a chair. You must be sitting in a cirtain position although it was the sort of position most people would have been sitting in anyway. There was also instructions about letting yourself relax and go with it if you felt it coming instead of resisting. The video itself which apparently fails at lower resolution featured some synthesized seeming sound and blury thin dark grey lines on a light or white background about 10 to the screen equally spaced where the view rotated. There was also the sugestion that this could be made more effective and was only made responsibly effective. What do we think? Edit: According to many Comments and much Twitter online it didn't work on many people at home.

I was using this diagram and had determined. http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/T/Transcription.html A --> A C --> C T --> U G --> C I don't understand how the transcription works if. DNA "ACTG" --> RNA "UGAC" Is it? A --> U C --> G T --> A G --> C However you talked about pairing with AT & CG. What did you mean? Required as well as the start codon to indicate the start of an RNA to be read? I thought it was the premoter that started the transcription and the start codon was something to be transcribed onto the mRNA? So the other sequences required for transcription go with the premoter? Presumably the DNA has to tell the RNA it just created to start at that particular start connection (the one we put at the start codon)? DNA creates RNA. RNA creates Proteins and can compute? I'm preposing that proteins do things, they act on the world? I found more than one possible sequence for this to choose from? Sounds like this like the others you mentioned are to do with the premoter?

Thanks, armed with this new knowlege I looked up the converstion. The DNA "ACTG" transcribes into the RNA "ACUG". ty, an important part. Best start our DNA sequence with a premotor or nothings going to happen, and then have something that will be transcribed to "AUG" so thats "ATG" so that the RNA that is created contains a start instruction and then "TAA" which converts to "UAA" which is one of the stop codons. The spaces in the below sequence don't represent anything except a change of function. TAATACGACTCACTATAGGGAGA ATG UAA TTGTCTGG A U AAACTAGA T A ACCAAGA? G A [Premoter] [start] [stop] DNA Program 1 Premote(Start, Stop) I presume (guestimate) that upstream means before and to the left?

I've read the wiki pages that are linked in this thread which I understand more parts of each time I re-read them. If I don't get your answers to some of my yet unanswered questions at first I don't mind, I can research and ask relevent questions untill I understand what you mean. At 29:34 this part is shown TAATACGACTCACTATAGGGAGA = Promoter The next slide then mearly shows "Promoter" followed by another part name instead of all the letters indevidually because then it would be a confusingly long string. I understand what your saying I just need some more smaller level details about what happens. I don't know what a "promoter" (or what the RNA transcribed (copied and adjusted\decompressed) from the DNA string above) does. If I knew what a "TAAT" did for example then I might be able to figure it out. If I knew assembly language and wanted to teach you then I wouldn't need to start with the molecular makeup of semiconductors, the mechanics of transistors or the electric flow inside printed circuits, although this is clearly different perhaps not too different.

Much of the media I have seen is about sequencing DNA, so you start with some DNA from a cell, read it, then implant it into a specal cell that morphs itself to become as the DNA instructs. It also says that for example one can change some letters from DNA of a lifeform that equate to a behaviour and replace it with some of your own then compile the life form using this special cell and that sequences of DNA letters can be used to create functions that are purly computational such as "a ring oscillator" and "logic gates" for others to put together to create fully functioning lifeforms. So the idea behind my languege was just the computational parts of DNA to work on such stuff without the lab or as they usually describe it sending off computer disks and getting bactera back. Iv'e never heard the tearm RNA sequencing and you say that DNA uncompressed into RNA to execute. So it much therefore be the case that they work with DNA because they can and it usefully turns into RNA which acts as you have coded it to. Are there any RNA commands (to disguard) that can not be constructed from decompressed DNA? If some viruses have no RNA and DNA does not compute just turns into usefull RNA then how do they function, grow, find cells to invade etc..?

As I understand it from you and the article in RNA the sequence is divided into groups of 3 for which it is practical to think of as 3 parallel sequences so you can think of each triplet as a unit of 64 states whereas in DNA each part is seperate? It also seems you are saying that RNA must start. AUG etc... Or to put it (a better?) way. A etc... U etc... G etc... I'm persuming in lack of other information that the RNA is read left to right and jumping back to the left is possible though some sequance. The article also says smart-ass coders or highly efficent lifeforms could use 3 different programs for the 3 offsets known as reading frames. It says that mRNA requires AUG to show the start of the section to be read. mRNA seems to be to do with transfering information inside a cell containing DNA as well, is this the same RNA that can be found in a virus? There is a nice table of commands that can be sumerised as. Go Stop Chemical There is a command to perform encode on an emino acid? Are the chemical comands all encoding the chemicals listed and what does this mean? Reguarding DNA, the most relevent seeming article is verry short. http://en.wikipedia.org/wiki/DNA_sequence

Thank you. What do you mean by pair? Take a small strand of RNA. "UUAU" I mean by 2bit that there are 2^2 = 4 possible states for each nucleotide. You might mean that each group of 2 work together somehow. "[uU][AU]" But I suspect you mean that two NA's have to be compaired to each other, or is this just for RNA because DNA is already duell stranded? although that dosn't make to much sence because both strands are the same in DNA. "UUAU" "UAUA" So if this is the case would it be some sort of substitution rule, possibly starting at one end or simultaneously? For example left to right "UA" "AU" becomes "AU" "UA" therefore "UUAU" "UAUA" ... "UUUA" "UAAU" ... (back to start) (program will no longer change)

I'm getting this when prices drop for my high performance laptop. http://www.engadget.com/2009/04/08/super-talent-ships-1-500-2-5-inch-masterdrive-rx-512gb-ssd http://www.supertalent.com/datasheets/6_169.pdf

I know we can sequence DNA in both directions and single celled lifeforms have been created that allow DNA to be implanted into them and they then turn into the lifeform described in the DNA. I don't know however how far allong we are in RNA but I understand that it has much of the same sorts of processing power. So in saying NA I was just refering to either. This is from a purly computational point of view though, I have no lab in which to do the practical things myself.

Because as Iv'e seen it you can code them on there own to perform computations for example logic gates and the such and you use a single line of text, although in reality they are not 1D they are double helixed (curly) that complication can probbably be abstracted out when thinking only about how to code them. Simmerlarly they must be able to construct, replicate, break apart, join up with other parts of themselves and the such. Although thease functions are probbably even more complicated to understand than the basic concepts of how to code them. Therefore at first I thought it would be most usefull to focus of the storing of state and computation along one line imagining it as being a 1D line. Merged post follows: Consecutive posts merged I clearly don't have any controll over how the languege works although components could be designed to work together nicely or not. Additionally a 2 level, a higher level code could be writtain and then converted to the 2Bit languege of life. Tell me more about what you meant.

I'm interested in computer science. I like all sorts of programming, from various programming langueges to the more unusual such as Cellular Automation (not to do with biological cells). Iv'e seen videos like this one, TED talks is also good for this sort of thing. http://video.google.co.uk/videoplay?docid=-6950604815683841321&ei=UZGNSommHoaJ-Ab2g4X0CA&q=dna+hacking&hl=en Can I get some information about what information transfer, storege of and acess to state and computation occurs allong the a DNA or RNA for what set of the four letters occur along the strand. To reduce the complication of this question we could presume the strand is 1D and ignore instructions that cause the NA to construct or interact with other strands. Iv'e posted this in computer science as I want to aproach this question from a coding (any sence of the word, not just syntactic languages) point of view.

lol, and I was thinking of this as a simple thing for my simple lack of electronics knowlege. Could make things like a self cooling thermos flask with a rechargeable button cell, a thermal unit and two pieces of wire. Power something with the warming effect of your body heat or alternativly cool you down with a few of the thinner ones in some clothing. I was imagining that if two were connected together with the wires that linked them crossed over then cooling one would cool the other and vice versa creating a sort of heat see-saw to synchronise the temperature between two places.

I was also imagining a rapid uncoiling effect from one opening in the barrel. I see you were thinking big with a barrel :¬P Thanks for the reply. Do any of the other alternatives outproform this one at such practical tempretures?

Thanks. There is lots of data like that on pages like this but little information. http://www.ferrotec.co.uk/products/thermal/modules/singleStage/ So if it's got 10 VMax then I will need to generate 10 volts to get -0.5* the \Delta T on one side and +0.5* the \Delta T on the other relative to the tempreture of the enviroment?

I wondered if this materal. http://www.mutr.co.uk/product_info.php?cPath=418_464&products_id=1151 Could be tightly coiled in a cointainer, then have heat such as (for simplicity) boiling water added into the container then the force to straighten the wire would be verry strong with potentally intresting applications.

bump

They are made of Cupro-Nickel.

Iv'e descovered that there fibreglass is a little denser than paper making 0.25mm far too thick.

Sorry to say coloring in a coin dosn't tend to work in a convincing way. I don't know what they are made of.

I want to discolor a 5 Indian Rupee coin to make it look like a £1 GBP coin. What chemicals would I use?

I think I was thinking about how much easyer it would be to suck into a long tube at first to pull something at the end along than a short tube at first, although yes, you would have to suck for longer to get to the same negative presure.

I was thinking about the pumatic pipe packet switching networks such as the one implemented under Paris a long time ago and it occured to me that they were replaced by electronic packet swiching networks for sending information, but that they would still make a good way of transfering goods. For example dried rice could be loaded into a tube in India and next week it would be in England. The longer the pipe the easyer it would be to get a low enough presure at one end to move the tube.

A button cell I found online has 3V and is 20mm * 2.5mm, therefore a 20mm * 100mm battery made of sperate cells could be 120V?

Thanks, I contacted a plastics manufactuer but they were no good as they only did thicker stuff. I'm trying the fibreglass people now and looking for other plastics and the such in case they are no good, but they do look promising, all the correct properties and suprisingly safe looking to use except I don't know yet about density. I'm also trying a speicalist paper manufacturer.

Yeah, it's not to bad on price if you only want small bits but not so practical for this. The disk would have to be cut from a large expensive bit.