Skip to content

Biochemistry and Molecular Biology

Discussion of protein structure, energetics, and molecular biology.

  1. Started by chinamadmonk,

    I read an abstract which mentioned "amino peptide", could anyone tell me what does the "amino peptide" mean in that article(I can not read Russian)?? I am puzzled:Is there any peptide with only N-end or C-end?? Cultivation of Haemophilus influenzae, serotype B, in amino peptide-based semisynthetic nutrient medium] [Article in Russian] Orlova OE, Vaneeva NP, L'vov VL, Iastrebova NE, Elkina SI, Sergeev VV, Kalina NG, Zakharova NE. Mechnikov Research Institute for Vaccines and Sera, State Research Center-Institute of Immunology, Moscow, Russia. The work shows the possibility of the cultivation of H. influenzae, serotype b, in semisynthetic nutrient medium …

    • 0

      Reputation Points

    • 7 replies
    • 12.7k views
  2. Started by kamalakar.teki,

    which enzymes is used for replication:-(

    • 0

      Reputation Points

    • 3 replies
    • 1.3k views
  3. I have taken an oral exam in TURKEY to qualify as an Assoc. Prof. The following question was asked and I did not know the answer, I failed the exam. They will ask it again. Pregnant women carries table sugar (sucrose) and when she gets hungry, she takes sugar, thus ketone bodies production decreases. If she is hungry for a long time, ketone body production will increase and that will cause Diabetes. In other words, Ketone bodies production causes Diabetes, what is the mechanism behind this phenomenon? As I know, Diabetes patients have higher ketone bodies production, since they can not use Glucose, body breaks down fats and free acids to Acetyl CoA which for…

    • 0

      Reputation Points

    • 6 replies
    • 7.2k views
  4. Hello, I have been looking through publications inorder to find the maximum rates of a few transporters... this is easy when data is shown as V vs. S you can just find Vmax from where the graph is leveling off however, some data for transporters is shown as DISTRIBUTION RATIO vs TIME (where distribution ratio = inside cell / outside cell) does anyone know: 1) why would someone display the data like this?...(ie. is it for transporters with very fast kinetics)? 2) how can you find Vmax for a transporter with this data?

    • 0

      Reputation Points

    • 1 reply
    • 1.4k views
  5. Started by mk_2007,

    Hi! I have just done a maldi tof- maldi tof tof, and am trying to calculate the b and y ions from the spectra. I have found an amino acid which is almost perfect except one thing! I get a peak corresponding to a tyrosine residue for y ions, but nowhere can i see one for b ions! can anyone suggest why this might be? x

    • 0

      Reputation Points

    • 0 replies
    • 1.1k views
  6. Started by erynna,

    Hi I recently ran a PCR and unfortunately I did not have any success. Just want to run over my protocol and my ideas to see if I’m heading in the right direction to get things running and to see if anyone has any suggestions on how they would attack this problem I extracted genomic DNA from plant leaves using a sigma Extract-N-Amp plant PCR kit (I have never used this kit before and I don’t know if anyone has had any success with it?). I stored the DNA at 4oC for 3 days before conducting the PCR. I ordered in a primer from sigma, using the following sequence: CCCAGCAACTGATCGCACAC (GC%=60%, Tmo=69.2) This primer is based on the universal rice primer (URP2R) …

    • 0

      Reputation Points

    • 5 replies
    • 3.1k views
    • 1 follower
  7. Started by ennui,

    Hello everyone, I've just found this forum today and I've been reading a few posts. It's very interesting, I'm glad I found it. I'm wondering if anyone out there knows a lot about molecular modelling (i.e. with PyMol) and X-ray fibre diffraction. Alas, I don't have access to solid-state NMR so I can't get any detailed knowledge of the oligomer I'm working with. As part of a research I'm investigating the structure of amyloid proteins by using X-ray fibre diffraction. I have a small de novo peptide which I've assembled into a fibre; from this, I've generated an X-ray diffraction pattern and electron micrographs. From both of these I've calculated a unit cel…

    • 0

      Reputation Points

    • 0 replies
    • 1.1k views
  8. Started by jungjedi,

    is there such a thing.does life function at a quantum level?could it be called quantum bio -mechanics?

    • 0

      Reputation Points

    • 13 replies
    • 2.8k views
  9. Started by mk_2007,

    Hi! I was wonderng if anyone knows why its useful to include uncut DNA in an electrophoresis when analysing the cut DNA restriction fragments?

    • 0

      Reputation Points

    • 4 replies
    • 6.8k views
  10. Started by lelly83,

    does anyone know where I can find some useful info about the TCA cycle? none of my books seem to have alot of info, dunno if im being daft and looking for the wrong thing.

    • 0

      Reputation Points

    • 2 replies
    • 1.3k views
  11. Started by StrongSide,

    Does anyone know where to find a plot of velocity vs. total enzyme concentration? Also, where to find a plot of velocity vs. [ES]? (For enzymes displaying Michaelis-Menten kinetics) I can't find them anywhere.

    • 0

      Reputation Points

    • 3 replies
    • 1.8k views
  12. Started by bioman2,

    Hi, am just a bit unsure about this area of the topic: When a weak acid dissociates into a proton and anion ... HA <==> H+ + A- Does the concentration of hydrogen ions (H+) always equal the concentration of the anion (A-) here? Also I have found the formula Total concentration = Concentration of ionised + concentration of undissociated. To use this formula would I take the "concentration of ionised" to be just [A-] or would it be [A-] + [H+]? I was thinking it would be just [A-]. Though am unsure of the explaination. Clearly for "concentration of undissociated" this would be [HA] value. Any help with this confusion would be gr…

    • 0

      Reputation Points

    • 1 reply
    • 1.1k views
  13. I'm giving a lecture called "The Biochemists' Toolbox." My lecture will consist of the aspects of protein engineering (expression vectors, expression systems, and probing protein structure/function via mutagenesis). I'm having trouble finding the pioneers of this field. I'm well aware of PCR (Kary Mullis), however, I don't know where to look for the rest. Any suggestions? Any classical experiments in this field anyone's aware of?

    • 0

      Reputation Points

    • 1 reply
    • 1.2k views
  14. if anyone here can help me with my biochem. project. =================================================== Glu binding site: Map out the Glu binding site and explain how Glu binds, you will need to consider the inhibitor phosphothricin as a good analog of glutamate.[7] Indicate which amino acid residues are important in stabilizing Glu in the binding site. Indicate which residues are involved in chemistry. ================================================== I can not find a single website that is usable for the project. Thanks in advance!! -J

    • 0

      Reputation Points

    • 4 replies
    • 1.4k views
  15. Hi all, This is my first post here, and was wondering if some of you more experienced microbiologists could give me some advice. I am working along with a Professor at a University, and I am performing my own individual research. Basically the goal is to introduce Arabidopsis thaliana plastids and sections of the genome into animal cells. I do not yet know what species or type of animal cell I should use - single celled, multicellular, etc. Also, if multicellular, should I use skin cells, muscle, nerve, etc. I know that different types of cells have different reactions to foreign DNA and some uptake DNA better than others. Also, I need a cell that can also cope with …

    • 0

      Reputation Points

    • 3 replies
    • 1.3k views
  16. Started by Fortissimo,

    In a hospital lab, a 10mL sample of gastric juice, obtained several hours after a meal, was titrated with a 0.1M NaOH to neutrality; 7.2mL of NaOH was required. The patients stomach contained no ingested food or drink, so it is assumed that no buffers were present. What was the pH of the gastric juice? I know it sounds really simple but I'm totally stumped. Could someone point me in the right direction?

    • 0

      Reputation Points

    • 0 replies
    • 1.5k views
  17. Started by biochemachiever,

    How does cholesterol control its own synthesis?

    • 0

      Reputation Points

    • 1 reply
    • 1.2k views
  18. Started by astrogirl15,

    Basicly i'm trying to find out where Histidine is made, and what outside forces help to make it, and how. Please give me something to work with here.

    • 0

      Reputation Points

    • 3 replies
    • 2.2k views
  19. Started by jabroney8,

    Hello Im trying to do immunoprecipitation on apolipoprotein A1 in human plasma. after transfer, i always ponceau stain the blot to check for transfer efficiency. I usually see a band aroung 28kDa, which is most likely APOA1, another band at 50, which is most likely Protein A/G, and another around 60kDa, which Im not sure what it is. Anyway, when i develop the blot colorimetrically, I see a train of about 8 lanes 1KDa apart from about 34kDa-26kDa that were not visible with ponceau stain. Im confused because the bands are very intense, do NOT show up on a ponceau stain, and are probably masking my protein of interest. i dont know if this train is protein or something els…

    • 0

      Reputation Points

    • 2 replies
    • 1.3k views
  20. Started by C_Sagan_Returns,

    Check this out. I've had the solution for weeks and I still can't figure out how to get these answers without pluging in all seven equations and seven unknowns (or whatever it is) into a calculator. I tried every possible combination and my professor doesn't help very much, he'll never show you step-by-step how to do something...he just repeats the theory to you over and over. I'm guessing it's just my poor algebra skills getting in the way. Can someone please show me how to go through part (2) of the solution (it's not shown step by step!!). Thanks, CSR

    • 0

      Reputation Points

    • 1 reply
    • 1.4k views
  21. Started by olenka,

    Hello I have a questions about isotopes and radioactivity. I have red that that isotope of carbon 14C can be placed at any position in the glucose molecule and then , measurement of radioactivity in the products will indicate the metabolic fate of the radioisotope. So, if glucose is labeled in one or more positions with 14C, and fed to fermenting yeast, which form or forms of 14 C-glucose would give the most radioactivity in CO2 and the least ethanol??? My second question is about arsenate. Arsenate is chemically similar to inorganic phosphate and is used by phosphate-requiring enzymes as an alternative substrate. However , inorganic arsenates are quite unstabl…

    • 0

      Reputation Points

    • 0 replies
    • 1.5k views
  22. Hello, I have a question with respect to the interpretation of Ki values from binding experiments: In receptor binding assays Ki values are generated for compounds along with given Kd values of the used radioligands. As far as I understand does such an Ki describe the affinity of the investigated compound towards the receptor and should be independent of the used radioligand. Is this true? Or does the Ki value also depend on the radioligand and its affinity used in the binding assay?

    • 0

      Reputation Points

    • 0 replies
    • 3.9k views
  23. Started by 19been85,

    Got a few questions which are really confusing me; Which of the electron transport chain complexes donates electrons to DCPIP and which complex accepts electrons? Why would cyanide increase the rate of DCPIP reduction? Lastly how would i estimate the redox potential of DCPIP, what information would i need to do so? Any help would be grrrrreat!

    • 0

      Reputation Points

    • 0 replies
    • 2.2k views
  24. Started by erynna,

    Has anyone had success using the Sigma Extract-N-Amp Plant PCR kit? My employer ordered this kit in before I started working and I’m not sure how successful it is. Does anyone have any experiences they can share? Erynna

    • 0

      Reputation Points

    • 0 replies
    • 1.1k views
  25. Started by erynna,

    Hi All I'm currently working in the UK designing practical classes for college students and I'm in need of some plant biotechnology advice. Would anyone be able to recommend me a universal plant primer to use in PCR? I'm not looking to amplify a specific gene or sequence but I'm having difficulties finding a primer which is appropriate. I have considered using a universal rice primer or a universal chloroplast primer. I just wish to demonstrate the procedure of PCR and DNA fingerprinting to the students. Erynna

    • 0

      Reputation Points

    • 2 replies
    • 1.6k views

Important Information

We have placed cookies on your device to help make this website better. You can adjust your cookie settings, otherwise we'll assume you're okay to continue.

Account

Navigation

Search

Search

Configure browser push notifications

Chrome (Android)
  1. Tap the lock icon next to the address bar.
  2. Tap Permissions → Notifications.
  3. Adjust your preference.
Chrome (Desktop)
  1. Click the padlock icon in the address bar.
  2. Select Site settings.
  3. Find Notifications and adjust your preference.