Biochemistry and Molecular Biology

Hello, I have been looking through publications inorder to find the maximum rates of a few transporters... this is easy when data is shown as V vs. S you can just find Vmax from where the graph is leveling off however, some data for transporters is shown as DISTRIBUTION RATIO vs TIME (where distribution ratio = inside cell / outside cell) does anyone know: 1) why would someone display the data like this?...(ie. is it for transporters with very fast kinetics)? 2) how can you find Vmax for a transporter with this data?

Hi! I have just done a maldi tof- maldi tof tof, and am trying to calculate the b and y ions from the spectra. I have found an amino acid which is almost perfect except one thing! I get a peak corresponding to a tyrosine residue for y ions, but nowhere can i see one for b ions! can anyone suggest why this might be? x

Hi I recently ran a PCR and unfortunately I did not have any success. Just want to run over my protocol and my ideas to see if I’m heading in the right direction to get things running and to see if anyone has any suggestions on how they would attack this problem I extracted genomic DNA from plant leaves using a sigma Extract-N-Amp plant PCR kit (I have never used this kit before and I don’t know if anyone has had any success with it?). I stored the DNA at 4oC for 3 days before conducting the PCR. I ordered in a primer from sigma, using the following sequence: CCCAGCAACTGATCGCACAC (GC%=60%, Tmo=69.2) This primer is based on the universal rice primer (URP2R) …

Hello everyone, I've just found this forum today and I've been reading a few posts. It's very interesting, I'm glad I found it. I'm wondering if anyone out there knows a lot about molecular modelling (i.e. with PyMol) and X-ray fibre diffraction. Alas, I don't have access to solid-state NMR so I can't get any detailed knowledge of the oligomer I'm working with. As part of a research I'm investigating the structure of amyloid proteins by using X-ray fibre diffraction. I have a small de novo peptide which I've assembled into a fibre; from this, I've generated an X-ray diffraction pattern and electron micrographs. From both of these I've calculated a unit cel…

is there such a thing.does life function at a quantum level?could it be called quantum bio -mechanics?

Hi! I was wonderng if anyone knows why its useful to include uncut DNA in an electrophoresis when analysing the cut DNA restriction fragments?

does anyone know where I can find some useful info about the TCA cycle? none of my books seem to have alot of info, dunno if im being daft and looking for the wrong thing.

Does anyone know where to find a plot of velocity vs. total enzyme concentration? Also, where to find a plot of velocity vs. [ES]? (For enzymes displaying Michaelis-Menten kinetics) I can't find them anywhere.

Hi, am just a bit unsure about this area of the topic: When a weak acid dissociates into a proton and anion ... HA <==> H+ + A- Does the concentration of hydrogen ions (H+) always equal the concentration of the anion (A-) here? Also I have found the formula Total concentration = Concentration of ionised + concentration of undissociated. To use this formula would I take the "concentration of ionised" to be just [A-] or would it be [A-] + [H+]? I was thinking it would be just [A-]. Though am unsure of the explaination. Clearly for "concentration of undissociated" this would be [HA] value. Any help with this confusion would be gr…

I'm giving a lecture called "The Biochemists' Toolbox." My lecture will consist of the aspects of protein engineering (expression vectors, expression systems, and probing protein structure/function via mutagenesis). I'm having trouble finding the pioneers of this field. I'm well aware of PCR (Kary Mullis), however, I don't know where to look for the rest. Any suggestions? Any classical experiments in this field anyone's aware of?

if anyone here can help me with my biochem. project. =================================================== Glu binding site: Map out the Glu binding site and explain how Glu binds, you will need to consider the inhibitor phosphothricin as a good analog of glutamate.[7] Indicate which amino acid residues are important in stabilizing Glu in the binding site. Indicate which residues are involved in chemistry. ================================================== I can not find a single website that is usable for the project. Thanks in advance!! -J

Hi all, This is my first post here, and was wondering if some of you more experienced microbiologists could give me some advice. I am working along with a Professor at a University, and I am performing my own individual research. Basically the goal is to introduce Arabidopsis thaliana plastids and sections of the genome into animal cells. I do not yet know what species or type of animal cell I should use - single celled, multicellular, etc. Also, if multicellular, should I use skin cells, muscle, nerve, etc. I know that different types of cells have different reactions to foreign DNA and some uptake DNA better than others. Also, I need a cell that can also cope with …

In a hospital lab, a 10mL sample of gastric juice, obtained several hours after a meal, was titrated with a 0.1M NaOH to neutrality; 7.2mL of NaOH was required. The patients stomach contained no ingested food or drink, so it is assumed that no buffers were present. What was the pH of the gastric juice? I know it sounds really simple but I'm totally stumped. Could someone point me in the right direction?

How does cholesterol control its own synthesis?

Basicly i'm trying to find out where Histidine is made, and what outside forces help to make it, and how. Please give me something to work with here.

Hello Im trying to do immunoprecipitation on apolipoprotein A1 in human plasma. after transfer, i always ponceau stain the blot to check for transfer efficiency. I usually see a band aroung 28kDa, which is most likely APOA1, another band at 50, which is most likely Protein A/G, and another around 60kDa, which Im not sure what it is. Anyway, when i develop the blot colorimetrically, I see a train of about 8 lanes 1KDa apart from about 34kDa-26kDa that were not visible with ponceau stain. Im confused because the bands are very intense, do NOT show up on a ponceau stain, and are probably masking my protein of interest. i dont know if this train is protein or something els…

Check this out. I've had the solution for weeks and I still can't figure out how to get these answers without pluging in all seven equations and seven unknowns (or whatever it is) into a calculator. I tried every possible combination and my professor doesn't help very much, he'll never show you step-by-step how to do something...he just repeats the theory to you over and over. I'm guessing it's just my poor algebra skills getting in the way. Can someone please show me how to go through part (2) of the solution (it's not shown step by step!!). Thanks, CSR

Hello I have a questions about isotopes and radioactivity. I have red that that isotope of carbon 14C can be placed at any position in the glucose molecule and then , measurement of radioactivity in the products will indicate the metabolic fate of the radioisotope. So, if glucose is labeled in one or more positions with 14C, and fed to fermenting yeast, which form or forms of 14 C-glucose would give the most radioactivity in CO2 and the least ethanol??? My second question is about arsenate. Arsenate is chemically similar to inorganic phosphate and is used by phosphate-requiring enzymes as an alternative substrate. However , inorganic arsenates are quite unstabl…

Hello, I have a question with respect to the interpretation of Ki values from binding experiments: In receptor binding assays Ki values are generated for compounds along with given Kd values of the used radioligands. As far as I understand does such an Ki describe the affinity of the investigated compound towards the receptor and should be independent of the used radioligand. Is this true? Or does the Ki value also depend on the radioligand and its affinity used in the binding assay?

Got a few questions which are really confusing me; Which of the electron transport chain complexes donates electrons to DCPIP and which complex accepts electrons? Why would cyanide increase the rate of DCPIP reduction? Lastly how would i estimate the redox potential of DCPIP, what information would i need to do so? Any help would be grrrrreat!

Has anyone had success using the Sigma Extract-N-Amp Plant PCR kit? My employer ordered this kit in before I started working and I’m not sure how successful it is. Does anyone have any experiences they can share? Erynna

Hi All I'm currently working in the UK designing practical classes for college students and I'm in need of some plant biotechnology advice. Would anyone be able to recommend me a universal plant primer to use in PCR? I'm not looking to amplify a specific gene or sequence but I'm having difficulties finding a primer which is appropriate. I have considered using a universal rice primer or a universal chloroplast primer. I just wish to demonstrate the procedure of PCR and DNA fingerprinting to the students. Erynna

Mainly ketone bodies are produced as by-products when fatty acids are broken down for energy in the liver and kidney. They are used as a source of energy in the heart and brain in case of starvation and diabetes. It has been found that ketone bodies are present in the blood of pragnent women and in neonates also. i want to know why they are produced in the them?

as some of you are already aware, growing Chili peppers is a hobby of mine. now I know that Chlorophil is the Green color in plants and Xanthophil is the Yellow colow. but what is the Red color?

Hi! Another question!! If you clone a gene, lets call it B, as a Xho I/Hind III fragment into a vector, then digest this vector with Hind III/Sal I, why would Xho I and Sal I sites be missing from the map? I know this is because, there is no restriction site for the Xho I and Sal I enzymes in the vector, but why? what could have happened to delete a restriction site? Help would be much appreciated!!!