Skip to content

longest word

Featured Replies

(1,185) Acetyl*seryl*tyrosyl*seryl*iso*leucyl*threonyl*seryl*prolyl*seryl*glutaminyl*phenyl*alanyl*valyl*phenyl*alanyl*leucyl*seryl*seryl*valyl*tryptophyl*alanyl*aspartyl*prolyl*isoleucyl*glutamyl*leucyl*leucyl*asparaginyl*valyl*cysteinyl*threonyl*seryl*seryl*leucyl*glycyl*asparaginyl*glutaminyl*phenyl*alanyl*glutaminyl*threonyl*glutaminyl*glutaminyl*alanyl*arginyl*threonyl*threonyl*glutaminyl*valyl*glutaminyl*glutaminyl*phenyl*alanyl*seryl*glutaminyl*valyl*tryptophyl*lysyl*prolyl*phenyl*alanyl*prolyl*glutaminyl*seryl*threonyl*valyl*arginyl*phenyl*alanyl*prolyl*glycyl*aspartyl*valyl*tyrosyl*lysyl*valyl*tyrosyl*arginyl*tyrosyl*asparaginyl*alanyl*valyl*leucyl*aspartyl*prolyl*leucyl*isoleucyl*threonyl*alanyl*leucyl*leucyl*glycyl*threonyl*phenyl*alanyl*aspartyl*threonyl*arginyl*asparaginyl*arginyl*isoleucyl*isoleucyl*glutamyl*valyl*glutamyl*asparaginyl*glutaminyl*glutaminyl*seryl*prolyl*threonyl*threonyl*alanyl*glutamyl*threonyl*leucyl*aspartyl*alanyl*threonyl*arginyl*arginyl*valyl*aspartyl*aspartyl*alanyl*threonyl*valyl*alanyl*isoleucyl*arginyl*seryl*alanyl*asparaginyl*isoleucyl*asparaginyl*leucyl*valyl*asparaginyl*glutamyl*leucyl*valyl*arginyl*glycyl*threonyl*glycyl*leucyl*tyrosyl*asparaginyl*glutaminyl*asparaginyl*threonyl*phenyl*alanyl*glutamyl*seryl*methionyl*seryl*glycyl*leucyl*valyl*tryptophyl*threonyl*seryl*alanyl*prolyl*alanyl*serine

who needs theoretical, the IUPAC name of human DNA would fill several libraries.

In my experience the longest word is Why? :mad: :mad: :mad:

who needs theoretical, the IUPAC name of human DNA would fill several libraries.

 

That would be interesting too see; one for every person on the planet would be a hell of a lot of books! They can't even agree on a name for a semi-complex compound so they have little hope of ever getting a name (nor would they want too I hope!)

well, this is where digital storage comes into its own. when you can shove a couple of libraries in a surprisingly small box.

well, this is where digital storage comes into its own. when you can shove a couple of libraries in a surprisingly small box.

 

Good point (with those new HDD disks in the making we are talking serious storage in a really small place already).

 

Could it be named by hand? No. Do we have the processing power capable of naming a full DNA strand? Probably but who would waste their time? Still, I'd love to see it ;)

scrolling through it would probably take a few years in itself.

Probably and I'd also like to find someone that could say the thing! Now that would be a feat worthy of recognition.

it could be the new memorizing pi to the nth number fad. who can remember their own DNA sequence to the most base pairs.

GTCAGTCAGTCGTGTAGTCGATGCTAGCTACGTAGTAGCTACGTACGTAGCTACGTAGC

TGTAGCTACGTAGCTAGTAGCTAGCTAGCTAGCTACGTACGATCGATGCTAGCATGCTG

CTAGTCGTTTCTAGGCCCAGTAGTTTCAGGAGATCGAGGAGACTAGGAGGGACTAGGA

TCGATCGATGAGTAGAGAGCTGCATGCGAGCAGCTAGGCATCGATCGTAGTGTCAAGT

AAACTGCATGCGATCGATGCTATGACTAGTCGTGAGCATGTGCTTTTTTTAGCTAGCCC

CAAAAACGATCGACGTCTATGTACGTACGTAGCGTAGTCGATCGGACTAGATGCTGCAT

ACCACACATCGTGCATGCTGATGCTGATGCTAGCTAGCTAGCTAGCTGTAGCGACTAGCT

 

BEAT THAT!

 

jk by the way

i have the sequence GATTACA 7 times in my DNA :P

 

lets see who gets this one.

technically, theoretical molecules can give you longer words than even that.

 

HOW?!

 

Is it just how their naming conventions are arranged?:confused:

 

who needs theoretical, the IUPAC name of human DNA would fill several libraries.

 

See above.

 

Linky?

HOW?!

 

Is it just how their naming conventions are arranged?:confused:

 

in theory, you could just keep adding functional groups and making the molecule name longer. Technically, there would be no upper limit to the size of the molecule, and the name of the compound. Obviously, physical laws don't actually allow for this to occur in nature.

Technical words shouldn't count, since they can just be indefinitely large.

 

The longest non-technical, non-proper noun, non-joke (a word created specifically to be long) word in the English language is flocci­nauci­nihili­pili­fication.

 

See: http://en.wikipedia.org/wiki/Longest_word

Archived

This topic is now archived and is closed to further replies.

Important Information

We have placed cookies on your device to help make this website better. You can adjust your cookie settings, otherwise we'll assume you're okay to continue.

Account

Navigation

Search

Search

Configure browser push notifications

Chrome (Android)
  1. Tap the lock icon next to the address bar.
  2. Tap Permissions → Notifications.
  3. Adjust your preference.
Chrome (Desktop)
  1. Click the padlock icon in the address bar.
  2. Select Site settings.
  3. Find Notifications and adjust your preference.