Hello everybody,

I'm a computer scientist and I've been working on algorithms for Genetics & Molecular Biology that detect & correct errors in DNA, mRNA, ... This work is unfortunately not available for free but property to the company I work for.

However, I've been thinking for quite a while about creating a new programming language (scripting language) for Biologists.

A language rich with biological structures and types such as : DNA, mRNA, Amino-Acids, Proteins, Cells, Viruses, ..., instead of the usual integers, floats, strings, ... , to help researchers and students make simulations of lab experiments.

Since I'm no biology expert I have certain questions I'd be happy to get answers to : Would it be "REALLY" helpful ? And, what kind of features would you advise me to implement ?

Cordialy.

I'm not sure biologists ever see 'the usual' as I'm sure they tend to prefer a set of tools and an input model such as FASTA, I'm no biologist either though. Maybe a set of solvers that could be used to build more complex models.

Hi,

What I'm talking about is a language to describe biological problems & implement solutions. Some biological functionalities will be implemented in the core of the language. This is a glimpse of what I'm talking about :

begin {

mRNA m = "AUGAACGCCAUUUUUGAUGGGCCCUAA";
Protein p = m.transcript();
Cell_T4 t4;

out("Name : ", p.name, newl, "Code : ", p.code, newl, "Sequence : ", p.sequence);

if (t4.connect(p) = true)
  out("T4 have receptors to protein ", p.name);
else
  out("T4 don't have receptors to protein ", p.name);

m.mutate("UUU", "UGC");

end }

This code :

- Creates an mRNA strand and assign a value to it,

- Transcripts that mRNA into a protein and assign the result to a variable of type Protein,

- Creates a T4 cell,

- Prints protein information : name, code & sequence (newl stands for new line),

- Checks if the protein connects to any T4 cell receptor and prints out a message,

- Mutates the previous mRNA by interchanging the UUU codon by UGC codon,

I hope you got my point ...

I have no experience with such things, but my guess is that rather than there being a biology programming language, there are libraries for existing languages. For example, a Google search just brought me to some python libraries.

 

http://biopython.org/wiki/Biopython

 

This page has a list of relevant python tools under the "Life Science" section. http://wiki.python.org/moin/NumericAndScientific

 

I'm sure there are similar resources out there for other languages. I just searched for python because I've fiddled with SciPy.

 

 

Is this helpful at all?

I have no experience with such things, but my guess is that rather than there being a biology programming language, there are libraries for existing languages. For example, a Google search just brought me to some python libraries.

 

http://biopython.org/wiki/Biopython

 

This page has a list of relevant python tools under the "Life Science" section. http://wiki.python.o...icAndScientific

 

I'm sure there are similar resources out there for other languages. I just searched for python because I've fiddled with SciPy.

 

 

Is this helpful at all?

 

Python seems to a kind of fact 'standard' PL for biology applications.

 

Hello everybody,

 

 

I'm a computer scientist and I've been working on algorithms for Genetics & Molecular Biology that detect & correct errors in DNA, mRNA, ... This work is unfortunately not available for free but property to the company I work for.

However, I've been thinking for quite a while about creating a new programming language (scripting language) for Biologists.

A language rich with biological structures and types such as : DNA, mRNA, Amino-Acids, Proteins, Cells, Viruses, ..., instead of the usual integers, floats, strings, ... , to help researchers and students make simulations of lab experiments.

Since I'm no biology expert I have certain questions I'd be happy to get answers to : Would it be "REALLY" helpful ? And, what kind of features would you advise me to implement ?

 

Cordialy.

 

Try this http://osq.cs.berkeley.edu/public/EChang-SystemsBiology.ppt

 

and this http://www.ncbi.nlm.nih.gov/pubmed/18647734

 

to get perspective.