Mohammed-Salah

Hi, What I'm talking about is a language to describe biological problems & implement solutions. Some biological functionalities will be implemented in the core of the language. This is a glimpse of what I'm talking about : begin { mRNA m = "AUGAACGCCAUUUUUGAUGGGCCCUAA"; Protein p = m.transcript(); Cell_T4 t4; out("Name : ", p.name, newl, "Code : ", p.code, newl, "Sequence : ", p.sequence); if (t4.connect(p) = true) out("T4 have receptors to protein ", p.name); else out("T4 don't have receptors to protein ", p.name); m.mutate("UUU", "UGC"); end } This code : - Creates an mRNA strand and assign a value to it, - Transcripts that mRNA into a protein and assign the result to a variable of type Protein, - Creates a T4 cell, - Prints protein information : name, code & sequence (newl stands for new line), - Checks if the protein connects to any T4 cell receptor and prints out a message, - Mutates the previous mRNA by interchanging the UUU codon by UGC codon, I hope you got my point ...

Hello everybody, I'm a computer scientist and I've been working on algorithms for Genetics & Molecular Biology that detect & correct errors in DNA, mRNA, ... This work is unfortunately not available for free but property to the company I work for. However, I've been thinking for quite a while about creating a new programming language (scripting language) for Biologists. A language rich with biological structures and types such as : DNA, mRNA, Amino-Acids, Proteins, Cells, Viruses, ..., instead of the usual integers, floats, strings, ... , to help researchers and students make simulations of lab experiments. Since I'm no biology expert I have certain questions I'd be happy to get answers to : Would it be "REALLY" helpful ? And, what kind of features would you advise me to implement ? Cordialy.