Lastweek, I synthesized cDNA from HEK293 cells and amplify RAD51-AP1 mRNA (BC016330.1) by PCR with the annealing temp of 65oC and with following primers: F-EcoRI: AT GAATTC A ATGGTGCGGCCTGTGAG; R-BamHI: AA GGATCC TCAGGTGCTAGTGGCATTTG and then I cloned this amplified fragment into P3XFLAG-CMV10 vector. However, the result of sequencing showed that I already cloned another gene which is CORO7-PAM16 mRNA. Please help me.
We have placed cookies on your device to help make this website better. You can adjust your cookie settings, otherwise we'll assume you're okay to continue.
Cloning of RAD51-AP1
in Biochemistry and Molecular Biology
Posted
Lastweek, I synthesized cDNA from HEK293 cells and amplify RAD51-AP1 mRNA (BC016330.1) by PCR with the annealing temp of 65oC and with following primers: F-EcoRI: AT GAATTC A ATGGTGCGGCCTGTGAG; R-BamHI: AA GGATCC TCAGGTGCTAGTGGCATTTG and then I cloned this amplified fragment into P3XFLAG-CMV10 vector. However, the result of sequencing showed that I already cloned another gene which is CORO7-PAM16 mRNA. Please help me.