Tony Posted June 27, 2003 Share Posted June 27, 2003 I have an idea to create the Genetic Engineering Programming Language. In the hope it would help biologists understand microscopic organisms. The language could allow biologists to build organisms in a computing environment using the sohpisticated language. What are your ideas? & What does the Genetic Engineering Programming Language mean to you. Link to comment Share on other sites More sharing options...
Sayonara Posted June 27, 2003 Share Posted June 27, 2003 Call it GEML - Genetic Engineering Markup Language. You'll get my vote. Link to comment Share on other sites More sharing options...
Guest Syntax Posted June 27, 2003 Share Posted June 27, 2003 I would actually help you make it, if you gave a specific documentation on the syntax. Genetic Engineering Modeling Code Gemco. Oh and whoever thought of "Genetic Engineering Markup Language" should reconsider, as a markup language is usually (if not, always) interpreted through a client. It is also insecure and can "sometimes" be inaccurate to use a markup language for something as high-scale as genetic engineering. Link to comment Share on other sites More sharing options...
Sayonara Posted June 28, 2003 Share Posted June 28, 2003 Originally posted by Syntax Oh and whoever thought of "Genetic Engineering Markup Language" should reconsider, as a markup language is usually (if not, always) interpreted through a client. It is also insecure and can "sometimes" be inaccurate to use a markup language for something as high-scale as genetic engineering. Why are you calling me "whoever" when my post is immediately above yours and it has my name on it? A markup language would be ideal for a genetic programming code. The fact that it is insecure and interpreted makes it more like a genome. Link to comment Share on other sites More sharing options...
Guest Syntax Posted June 28, 2003 Share Posted June 28, 2003 Ok "Sayonara³", a markup language would be retarded to use for a genetic engineering simulation language. As a markup language is completely static, and by no means could a static language be used for anything to deal with something as dynamic as life. Also, markup languages are too high-level, and would rely on layer upon, layer upon layer of interpretation, and would be completely inefficient and slow. Link to comment Share on other sites More sharing options...
Sayonara Posted June 28, 2003 Share Posted June 28, 2003 Originally posted by Syntax Ok "Sayonara³", a markup language would be retarded to use for a genetic engineering simulation language. As a markup language is completely static, and by no means could a static language be used for anything to deal with something as dynamic as life. Also, markup languages are too high-level, and would rely on layer upon, layer upon layer of interpretation, and would be completely inefficient and slow. Which would pretty much simulate a DNA-based organism perfectly, "Syntax". I use markup and compiled languages every day, I have a degree in Biology. It's not like I just typed whatever popped into my head at the time. I really don't see a problem with the markup language being... (A) Static. Do you know anyone who has DNA that changes? (B) Interpreted. Well, that's what happens in cells. And Tony wants to simulate that process. Or did you not read his post and just come up with 'what he meant' in your head? © Inefficient and slow. Just like the basis of life. Hurrah for junk code, hallelujah for life spans. And how come you aren't banned anymore. Link to comment Share on other sites More sharing options...
Guest Syntax Posted June 29, 2003 Share Posted June 29, 2003 Genetic Engineering is by no means "static" You've related life with computers, and talking about interpreted languages and how slowness relates to the subject when you're evading the entire point. You've made yourself look like an ass by trying to call it GEML. A markup language would output completely static information, and i wasn't referring it to be a static language. Infact, I think it'd be useless to make a language for Genetic Engineering, Unless it was a visual modelling application. Oh, and by the way, dont worry about why I'm unbanned, or how. Link to comment Share on other sites More sharing options...
Sayonara Posted June 29, 2003 Share Posted June 29, 2003 Don't you concern yourself with what I should worry about, and stop trying to provoke a response or you'll find yourself banned again. The simple fact is that a markup language would be ideal for doing what Tony wanted to do. If you misread his idea, don't take it out on me. The idea that you know nothing about genetics is much more likely than the idea that I know nothing about computer languages. Link to comment Share on other sites More sharing options...
Guest Syntax Posted July 2, 2003 Share Posted July 2, 2003 That was me, I got a bit too hype. Sayanora, I'm not going to argue any more because even though you may have a degree in biology, I do have alot of experience in system design. So this arguement would continue to loop until one of us just stopped. Link to comment Share on other sites More sharing options...
Sayonara Posted July 2, 2003 Share Posted July 2, 2003 Originally posted by Sayonara³ I use markup and compiled languages every day Link to comment Share on other sites More sharing options...
JaKiri Posted July 2, 2003 Share Posted July 2, 2003 Bald at 15 are we? Link to comment Share on other sites More sharing options...
Guest Syntax Posted July 2, 2003 Share Posted July 2, 2003 I use compiled languages every day, as well as a markup language, but that doesn't prove i know anything about how they work. I also use languages in which i've created, and I know the difficulty of trying to create a modelling system into a markup language, as a markup language has static linking. I may not have a degree in anything, but I do know that biology is life, and if a human moves, than it's dynamic. Using markup language would have no point. A scripting language on the other hand would, as a markup language has NO syntax pragmatics. Meaning, the code produced is simply the code produced and can not be manipulated, which would be useless for dealing with anything to do with life. If I were going to do anything with genetics, i'd do it in a visual enviroment with 3D objects, with trial and error-type checking. Link to comment Share on other sites More sharing options...
Sayonara Posted July 2, 2003 Share Posted July 2, 2003 And, knowing about genetics and languages, I wouldn't. One might imagine there's a reason. Link to comment Share on other sites More sharing options...
Tony Posted July 7, 2003 Author Share Posted July 7, 2003 O.K but what should it be. 1) Should it be a language where you program new computer applications such as C++ using genetic code are the rule setter. So instead of compiling, linking and building a program writtem in C++, you instead, generate DNS fragments, join it to a carrier module and them introduce it to the host cell for amplification. or 2) Should it be a language where you can create new organisms based on typing AGCT which are latter put into classess. I think the latter. We could probably then put all the new organisms in an aquariem and create a screensaver Link to comment Share on other sites More sharing options...
Tony Posted July 7, 2003 Author Share Posted July 7, 2003 http://www.freewebs.com/gemco/ Link to comment Share on other sites More sharing options...
Sayonara Posted July 7, 2003 Share Posted July 7, 2003 Genetic Engineering Makup Language or Genetic Engineering Modelling Code, Ask God!God says "He loves you" AS for the world it can't agree. Bald at 15 are we? lol Link to comment Share on other sites More sharing options...
Guest dux Posted September 18, 2003 Share Posted September 18, 2003 i think there is something already called GEPL sounds interesting tho Link to comment Share on other sites More sharing options...
phoenix Posted October 27, 2003 Share Posted October 27, 2003 Sayonara, can you please stop bullshitting about representing DNA or protein sequences in a markup format? Thank you. Genetic engineering language? I doubt your protein renders are up to it! Just my 2 cents. Phoenix Link to comment Share on other sites More sharing options...
Sayonara Posted October 27, 2003 Share Posted October 27, 2003 phoenix said in post #19 :Sayonara, can you please stop bullshitting about representing DNA or protein sequences in a markup format? Thank you. It would be nice if you could explain specifically what's wrong with that. Link to comment Share on other sites More sharing options...
phoenix Posted October 28, 2003 Share Posted October 28, 2003 Oh, I think I'm beginning to see what you may have meant - although I am unconvinced in so far as lack of an example is concerned! Something like this might have an application: acgtgtatgctgctgatcgtgtgttgtg<gene>agtacacggagcatgcgt<RNA>agtcgtcacccagtc<CDS>acgtgtgtca</CDS></RNA> The question remains whether sequence features are always hierarchic, and I have a strong intuitive feeling that they are not! How are you going to illustrate complex protein kinks in a markup language? Genetic engineering, in so far as whole organisms are concerned, must take account first of DNA sequence features, second of RNA folding, third of the four levels of protein structure, plus chemical gradients and structures that establish tissues and wire up neurons in the right places, etc. etc. It sounds more like a streaming format would be required rather than a human-readable markup language (that is the entire point of a markup language!) So to repeat my previous words, with emphasis: Sayonara, can you please stop bullshitting about representing DNA or protein sequences in a markup format? So I'm not sure whether I can be judged to have been owing you an explanation, but here we are. Greetings, Phoenix Link to comment Share on other sites More sharing options...
Sayonara Posted October 28, 2003 Share Posted October 28, 2003 lol I see what you mean. I am fully aware that a markup language might end up being horribly complex in this application, but I was enjoying arguing with Syntax. Unfortunately half of his posts (and mine too) have been deleted because it was a bit of a cat fight. From Tony's original post I was under the impression that he was discussing a system that any old biologist could pick up quickly to represent raw genomic information. But I agree; If you want a complex, hierarchial system for representing protein expression, etc... markup won't cut the mustard. Unless it was a horribly convoluted XML-based application, but in that case you'd have to program your own "interpreter" anyway. Link to comment Share on other sites More sharing options...
Recommended Posts
Create an account or sign in to comment
You need to be a member in order to leave a comment
Create an account
Sign up for a new account in our community. It's easy!
Register a new accountSign in
Already have an account? Sign in here.
Sign In Now