Jump to content

Cloning of RAD51-AP1


Recommended Posts

Lastweek, I synthesized cDNA from HEK293 cells and amplify RAD51-AP1 mRNA (BC016330.1) by PCR with the annealing temp of 65oC and with following primers: F-EcoRI: AT GAATTC A ATGGTGCGGCCTGTGAG; R-BamHI: AA GGATCC TCAGGTGCTAGTGGCATTTG and then I cloned this amplified fragment into P3XFLAG-CMV10 vector. However, the result of sequencing showed that I already cloned another gene which is CORO7-PAM16 mRNA. Please help me.

Link to comment
Share on other sites

Create an account or sign in to comment

You need to be a member in order to leave a comment

Create an account

Sign up for a new account in our community. It's easy!

Register a new account

Sign in

Already have an account? Sign in here.

Sign In Now
×
×
  • Create New...

Important Information

We have placed cookies on your device to help make this website better. You can adjust your cookie settings, otherwise we'll assume you're okay to continue.