Jump to content


Photo
- - - - -

Biology Programming Language


  • Please log in to reply
4 replies to this topic

#1 Mohammed-Salah

Mohammed-Salah

    Lepton

  • Members
  • 2 posts

Posted 25 May 2012 - 08:08 PM

Hello everybody,


I'm a computer scientist and I've been working on algorithms for Genetics & Molecular Biology that detect & correct errors in DNA, mRNA, ... This work is unfortunately not available for free but property to the company I work for.
However, I've been thinking for quite a while about creating a new programming language (scripting language) for Biologists.
A language rich with biological structures and types such as : DNA, mRNA, Amino-Acids, Proteins, Cells, Viruses, ..., instead of the usual integers, floats, strings, ... , to help researchers and students make simulations of lab experiments.
Since I'm no biology expert I have certain questions I'd be happy to get answers to : Would it be "REALLY" helpful ? And, what kind of features would you advise me to implement ?


Cordialy.
  • 0

#2 Xittenn

Xittenn

    Atom

  • Senior Members
  • 1,560 posts
  • LocationDelta, BC; Canada

Posted 26 May 2012 - 01:59 AM

I'm not sure biologists ever see 'the usual' as I'm sure they tend to prefer a set of tools and an input model such as FASTA, I'm no biologist either though. Maybe a set of solvers that could be used to build more complex models.
  • 0
"He is their god! He leads them like a thing made by some other deity than Nature that shapes man better. And they follow him against us brats with no less confidence than boys pursuing summer butterflies, or butchers killing flies." - Cominius; Shakespears Coriolanus

#3 Mohammed-Salah

Mohammed-Salah

    Lepton

  • Members
  • 2 posts

Posted 26 May 2012 - 11:13 AM

Hi,


What I'm talking about is a language to describe biological problems & implement solutions. Some biological functionalities will be implemented in the core of the language. This is a glimpse of what I'm talking about :


begin {

mRNA m = "AUGAACGCCAUUUUUGAUGGGCCCUAA";
Protein p = m.transcript();
Cell_T4 t4;
 
out("Name : ", p.name, newl, "Code : ", p.code, newl, "Sequence : ", p.sequence);

if (t4.connect(p) = true)
   out("T4 have receptors to protein ", p.name);
else
   out("T4 don't have receptors to protein ", p.name);

m.mutate("UUU", "UGC");

end }


This code :


- Creates an mRNA strand and assign a value to it,
- Transcripts that mRNA into a protein and assign the result to a variable of type Protein,
- Creates a T4 cell,
- Prints protein information : name, code & sequence (newl stands for new line),
- Checks if the protein connects to any T4 cell receptor and prints out a message,
- Mutates the previous mRNA by interchanging the UUU codon by UGC codon,



I hope you got my point ...
  • 0

#4 the asinine cretin

the asinine cretin

    Atom

  • Senior Members
  • 279 posts
  • LocationUranus

Posted 26 May 2012 - 11:36 AM

I have no experience with such things, but my guess is that rather than there being a biology programming language, there are libraries for existing languages. For example, a Google search just brought me to some python libraries.

http://biopython.org/wiki/Biopython

This page has a list of relevant python tools under the "Life Science" section. http://wiki.python.o...icAndScientific

I'm sure there are similar resources out there for other languages. I just searched for python because I've fiddled with SciPy.


Is this helpful at all?
  • 0
video removed by staff

#5 juanrga

juanrga

    Molecule

  • Senior Members
  • 720 posts
  • LocationEurope

Posted 26 May 2012 - 04:35 PM

I have no experience with such things, but my guess is that rather than there being a biology programming language, there are libraries for existing languages. For example, a Google search just brought me to some python libraries.

http://biopython.org/wiki/Biopython

This page has a list of relevant python tools under the "Life Science" section. http://wiki.python.o...icAndScientific

I'm sure there are similar resources out there for other languages. I just searched for python because I've fiddled with SciPy.


Is this helpful at all?


Python seems to a kind of fact 'standard' PL for biology applications.

Hello everybody,


I'm a computer scientist and I've been working on algorithms for Genetics & Molecular Biology that detect & correct errors in DNA, mRNA, ... This work is unfortunately not available for free but property to the company I work for.
However, I've been thinking for quite a while about creating a new programming language (scripting language) for Biologists.
A language rich with biological structures and types such as : DNA, mRNA, Amino-Acids, Proteins, Cells, Viruses, ..., instead of the usual integers, floats, strings, ... , to help researchers and students make simulations of lab experiments.
Since I'm no biology expert I have certain questions I'd be happy to get answers to : Would it be "REALLY" helpful ? And, what kind of features would you advise me to implement ?

Cordialy.


Try this http://osq.cs.berkel...temsBiology.ppt

and this http://www.ncbi.nlm....pubmed/18647734

to get perspective.
  • 0




0 user(s) are reading this topic

0 members, 0 guests, 0 anonymous users